^1,4M. Sc. Student, Immunology Research Center, and Department of Microbiology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran

^2,3Immunology Research Center, and Department of Microbiology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran

Article Publishing History

INTRODUCTION

Staphylococcus aureus is a Gram-positive opportunistic bacterium of great clinical significance, expressing diverse virulence factors that facilitate its adherence, colonization, intercellular interaction, immune system evasion, and tissue damage. Moreover, this microorganism has developed resistance to â-lactam antibiotics by â-lactamase expression or the presence of penicillin binding protein 2a (PBP2a) directly related with methicillin-resistant S. aureus (MRSA) strains.The mec A gene codifies for PBP2a and is a structural part of a mobile genetic element named Staphylococcal cassette chromosome mec (SCCmec), which can insert itself into a specific region of its central genome. The different types of SCCmec are classified according to the combination of the mec complex (mecA gene and its regulators) and the cassette chromosomal recombinase (ccr), which codifies for enzymes responsible for SCCmec mobility. Mec A gene is not present in methicillin-sensitive S. aureus (MSSA) strains and the presence of this gene is regarded as a criterion of resistance (Merlino, Watson et al. 2002 Llarrull, Fisher et al. 2009 Chambers and DeLeo 2009 Jensen and Lyon 2009, Borbón-Esquer, Villaseñor-Sierra et al. 2014).

In 1961 the first MRSA strain was identified in the United Kingdom. Especially in the past two decades the prevalence of these strains have increased in the world (El-Din, El-Shafey et al. 2003). These strains are usually associated with hospital-acquired infections (HA-MRSA) that shows resistance to many antibiotics, including â-lactams, semi-synthetic penicillins, cephalosporins and carbapenems. The prevalence of HA-MRSA is variable in different parts of the world, ranging from 4.1% in Panama up to 59% in Korea (Klevens, Edwards et al. 2006, Klein, Smith et al. 2007, Alvarez, Ramirez et al. 2008).

Genotyping of MRSA strains has been employed in epidemiological studies to determine its prevalence, dissemination, risk factors, and association with antimicrobial resistance (Kondo, Ito et al. 2007). Production of the Panton – Valentine leukocidin (PVL) in MRSA strains is considered to be associated with disease severity (Lina, Piémont et al. 1999). PVL is a Staphylococcal leukocidin which only attacks macrophages and polymorphonuclears, and has two components “S (33kDa)” and “F (34kDa)” which is controlled by luk S-PV and luk F-PV genes, respectively (Narita, Kaneko et al. 2001). With respect to the presence of certain chromosomal cassettes, the majority of the published studies have shown an association of SCCmec type II strains with hospital infections, whereas type IVa strains, with or without the presence of the pvl gene, have been associated with community-acquired infections (Borbón-Esquer, Villaseñor-Sierra et al. 2014).The aim of the present study was to determine the prevalence of pvl gene in MRSA isolates by genotypic methods in clinical specimens.

MATERIAL AND METHODS

Bacterial Isolates

A total of 710 different clinical specimens, including urine, wound, blood, broncho-alveolar lavage, skin and soft tissue, cerebrospinal fluid and body fluids were studied for isolation of S. aureus during January-December 2015 from patients admitted to several hospitals in Urmia city, West Azerbaijan, Iran. Initially, all isolates were identified using standard microbiological and laboratory methods, including growth on blood agar and type of hemolysis, Gram stain, catalase test, growth on mannitol salt agar, slide and tube coagulase tests, and DNase test (Forbes et al. 2007). Later, all S. aureus isolates were stored in nutrient broth supplemented with 15% glycerol at -20°C until use.

Phenotypic Detection Of Mrsa Isolates

Resistance to methicillin was determined by Kirby – Bauer disk diffusion method on Muller Hinton agar (MHA) using cefoxitin disk (Hi Media, India) as described in the guidelines of Clinical and Laboratory Standards Institute (CLSI) documents . As recommended in the CLSI guidelines, direct colony suspension method was used for testing of S. aureus isolates for potential methicillin and or oxacillin resistance. The plates were incubated at 35°C for 18–24 hours aerobically, and growth inhibition zones around the disk was measured. Inhibition zone diameters ≤21 mm considered as resistant. Any visible growth within the zone of inhibition was also considered as methicillin resistant.

Dna Extraction

DNA extraction was performed according to Sadeghi et al. (Sadeghi and Mansouri 2014). Briefly, for making a starter culture, a single colony of S. aureus was inoculated on nutrient agar. Three or four colonies of overnight growing bacteria from the starter culture were suspended in 450 μl of TE (Tris-EDTA) buffer (10 mM Tris, 1 mM EDTA, pH 8). Cell lysis was obtained by treatment with 5 μl of proteinase K (20 mg/mL) for 20 min at 50 °C followed by addition of 60 μl of 10% SDS for 10 min at 68 °C. In the next step, 80 μl of cetyltrimethylammonium bromide (CTAB)/NaCl and 100 μl of 5 M NaCl were added and incubated at 65 °C for 10 min. Then, chloroform/isoamyl alchohol (700 μl) was added and centrifuged at 11000 × g for 8 min. Supernatant was transferred to another tube and the DNA was precipitated with isopropanol, washed with 70% ethanol, dried, and dissolved in 100 μl of deionized water.

Molecular Detection Of Mec A Gene

All S. aureus isolates were evaluated by PCR amplification for detection of mecA gene by using mecA P4 (5’-TCCAGATTACAACTTCACCAGG-3’) and mecA P7 (5’- CCACTTCATATC TTGTAACG-3’) primers (McClure, Conly et al. 2006). PCR performed in a 25μl volume containing 10 pmol of each primers, 200 μM dNTP (Roche, Germany), 2.5 μl (50 mM MgCl2), 0.5 μl Taq polymerase (2.5 u) (Roche, Germany), 5 μl PCR buffer 10x (Roche,Germany) and 5 μl DNA-template. S.aureus ATCC 33591 and ATCC 25923 were used as positive and negative controls, respectively. The following PCR condition was used: 94°C (4 min),30 cycles with 94°C (45 s) ,56°C (45 s), 72°C (1 min) and finally 72°C (7 min) ; 4°C hold.

Molecular Detection Of Pvl Gene

PCR for detection of pvl gene was carried out by using primers as below: 

pvl-1:5’ATCATTAGGTAAAATGTCTGGACATGATCCA–3’ and pvl-2: 5’ GCATCAAGTGTATTGGATAGCAAAAGC – 3’ (McClure, Conly et al. 2006). PCR performed in a 50 μl containing 20 pmol of each primer, 5 μl of 10x buffers, 1.5 μl of dNTP (10pmol), 3 μl of MgCl₂ and 32.5 μl of distilled water and 4 μl of the template DNA. DNA denatured for 5 minutes at 95 °C following with 35 cycles of denaturing performed for 30 S at 92°C, with annealing at 55 °C for 30 S, extension at 72 °C for 45 S and finally, 10 minutes of the final extension performed at 72 °C.

Agarose Gel Electrophoresis For Detection Of Pcr Products

PCR products were visualized following electrophoresis in 1.7% agarose gels run at 70 V with ethidium bromide staining (Sigma, USA). pvl gene and mecA gene positive isolates yielded an amplification product of shining band in 433 and 162 base pair, respectively, with the standard positive control under UV trans-illuminator (UVP, USA) (SANTOS, TEIXEIRA et al. 1999).

Statical Analysis

Data were analyzed using SPSS statistical software (version 15, SPSS, Chicago, USA), Chi-square exact test was used to test for significant association between categorical variables. P-value less than 0.05 was considered
significant.

Results And Discussion

Distribution of methicillin resistant S. aureus:

Out of 710 clinical specimens, 114 isolates (16%) were confirmed as S. aureus, of which 48 (42.1%) were recorded as methicillin resistant, mostly isolated from urine, wound discharge and blood (Table1).

Table 1: Distribution of methicillin-resistant Staphylococcus aureus (MRSA) isolates according to clinical specimens.
Specimens	No. of S. aureus isolates (%)	MRSA (%)
Urine	33(28.94)	16(14.03)
Wound	29(25.43)	15(13.15)
Blood	14(12.28)	8(7.01)
Broncho-alveolar lavage	11(9.64)	3(2.63)
Skin and soft tissue	8(7.01)	1(0.87)
Cerebrospinal fluid	7(6.14)	3(2.63)
Body fluids	5(4.38)	1(0.87)
Other specimens	7(6.14)	1(0.87)
Total	114(100)	48(42.1)

Phenotypic detection of methicillin resistant S. aureus and molecular detection of mecA gene:

The presence of mecA gene using PCR considered as the gold standard method for calculating the specificity and sensitivity of the other tests in this study. Results from conventional disk diffusion susceptibility tests correlated very well with those from the PCR assay. The cefoxitin disk detected MRSA isolates correctly in all cases compared to the presence of mecA gene by PCR (42.1%) (Figure 1). Entirely based on cefoxitin disc results there was no substantial differences between conventional susceptibility testing and PCR for calculating methicillin resistant S. aureus (p>0.05). The overall results obtained with different techniques are shown in Table 2.

Table 2: Sensitivity and specificity of diagnostic methods in identification of methicillin-resistant S. aureus.
Test	No. of MRSA identified (%)	Sensitivity	Specificity
Cefoxitin disk	48(40.67%)	100%	100
mecA	48(40.67%)	100%	100

Figure 1: PCR products for the pvl gene. Lane 1: 100 bp molecular weight marker. Lane 2: Staphylococcus aureus pvl gene-positive control. lanes 3-6: pvl positive Staphylococcus aureus isolates (433bp).

Detection of MRSA isolates carrying pvl gene:

Among MRSA isolates, 13 (27%) contained pvl genes and the remaining isolates were recorded as pvl negative (Figure 2).

1. aureusis one of the most common infectious agents which has become a frequent cause of nosocomial infection. This bacterium is simply gained and comprises potential to become resistant to many common in-use antibiotics and the prevalence of resistant strains posing serious therapeutic and infection control problems within the hospital environment (Khosravi, Hoveizavi et al. 2012). The infections caused by MRSA are important and can even cause mortality, so increasing antibiotic resistance is a concern and should be monitored (Merlino, Watson et al. 2002).

Approximately 89.4 million persons (32%) and 2.3 million persons (0.8%) of the US population are colonized with S.aureus and MRSA, respectively (Kuehnert, Hill et al. 2005). The rate of MRSA in all community-associated S.aureus infections ranges from 2.5% to 39% in Asian countries (Vandenesch, Naimi et al. 2003). In our study, 42.1% of isolates were recorded as MRSA, while other studies conducted in Iran have shown MRSA prevalence is 55% in Tehran (Saderi, Habibi et al. 2008), 37% in Tabriz (NIKBAKHT, Nahaei et al. 2007) and 50% in Hamedan (Zamani, Sadeghian et al. 2007).

Figure 2: PCR products for the mecA gene. Lane 1: 100 bp molecular weight marker. Lane2: Positive control (MRSA). Lanes 3, 4 and 6: mecA positive Staphylococcus aureus isolates (162bp). Lane 5: Negative control.

Such strains can be spread by close contact with an infected person, touching contaminated surfaces and stuffs, unhealthy and crowded living conditions and poor personal hygiene. In addition, MRSA is difficult to treat due to multi-drug resistance and cause confusion in the usual sensitivity tests to detect the resistance due to non-uniform expression of them. Therefore, the detection of mecA and pvl genes represents a quick and more specific method for early identification of CA-MRSA isolates (McClure, Conly et al. 2006). Also, a combination of mecA and pvl genes is capable to produce super adaptable S. aureus strains (22-25). Most of CA-MRSA strains have the virulence factor, PVL, which is not often found in HA-MRSA or MSSA strains. But a low occurrence of MSSA was reported, and has been led to necrotizing pneumonia and death (Vandenesch, Naimi et al. 2003).

In recent years, an impressive worldwide spread of PVL-positive CA-MRSA clones have been observed (Francis, Doherty et al. 2005). Out of the MRSA isolates in our study, 27% carried PVL-encoding genes. Previous studies in Iran have reported the prevalence to be 19% in the capital of Iran; Tehran (Lari, Pourmand et al. 2011), 7.23% in the Southwest; Ahvaz (Khosravi, Hoveizavi et al. 2012), and 5.47% in the South; Shiraz (Alfatemi, Motamedifar et al. 2014). In contrast to the present study, some previous reports have described an extremely high prevalence of pvl genes in MRSA. In Western Nepal, Tunisian and Texas, the prevalence of PVL-positive MRSA isolates was 56.8%, 79%, 94.9% respectively (Bocchini, Hulten et al. 2006, Mariem, Ito et al. 2013, Bhatta, Cavaco et al. 2016). Some investigations revealed a low prevalence of PVL genes in MRSA. In Turkey, UK and Austria PVL-positive MRSA occurrence were detected 1.3%, 1.6%, 3.7%, respectively (Holmes, Ganner et al. 2005, Krziwanek, Luger et al. 2007, Kilic, Guclu et al. 2008). These findings may reflect the difference in the prevalence of this gene in different geographic regions and also kind of assay used for detecting the genes.

Since there is a strong evidence of involvement of pvl gene in pathogenesis of S. aureus strains, so diagnosis and treatment of infections caused by S. aureus strains harboring these genes is very important. Detection of PVL is commonly carried out by using molecular techniques (Khosravi, Hoveizavi et al. 2012). According to the results of this study, the phenotypic methods with cefoxitin susceptibility testing and PCR assay for MRSA gene can be useful for definite diagnosis of MRSA strains. Our study was limited because SCCmec typing was not performed.

CONCLUSION

In conclusion, the prevalence of PVL-positive MRSA isolates, found to be 27% in this study, justify further detailed inspection to prevent possible future endemics in the studied hospitals and likewise other hospitals in the region. Moreover, if these strains spread to parts of hospital, including pediatrics, intensive care and cardiac intensive care unit could be life threating. Therefore, identification of these strains and treatment of relative infections is important in prevention of colonization and spread.

ACKNOWLEDGMENT

The authors are grateful to Immunology Research Center of Tabriz University of Medical Sciences for supporting this study to be undertaken.

REFERENCES

Clinical and Laboratory Standards Institute/NCCLS (2005). Performance Standards for Antimicrobial Susceptibility Testing; Fifteenth Informational Supplement. CLSI/ NCCLS documents M100-S15. USA.

Alfatemi, S. M. H., M. Motamedifar, N. Hadi and H. S. E. Saraie (2014). Analysis of virulence genes among methicillin resistant Staphylococcus aureus (MRSA) strains. Jundishapur journal of microbiology 7(6).

Alvarez, J., A. Ramirez, M. Mojica-Larrea, J. R. Huerta, J. Guerrero, A. Rolon, H. Medina, J. Munoz, J. Mosqueda and A. Macias (2008). [Methicillin-resistant Staphylococcus aureus at a general hospital: epidemiological overview between 2000-2007]. Revista de investigacion clinica; organo del Hospital de Enfermedades de la Nutricion 61(2): 98-103.

Bhatta, D. R., L. M. Cavaco, G. Nath, K. Kumar, A. Gaur, S. Gokhale and D. R. Bhatta (2016). Association of Panton Valentine Leukocidin (PVL) genes with methicillin resistant Staphylococcus aureus (MRSA) in Western Nepal: a matter of concern for community infections (a hospital based prospective study). BMC infectious diseases 16(1): 1.

Bocchini, C. E., K. G. Hulten, E. O. Mason, B. E. Gonzalez, W. A. Hammerman and S. L. Kaplan (2006). Panton-Valentine leukocidin genes are associated with enhanced inflammatory response and local disease in acute hematogenous Staphylococcus aureus osteomyelitis in children. Pediatrics 117(2): 433-440.

Borbón-Esquer, E. M., A. Villaseñor-Sierra, E. Martínez-López, J. J. Jáuregui-Lomeli, R. Villaseñor-Martínez and M. d. R. Ruiz-Briseño (2014). SCC mec types and pvl gene in methicillin-resistant Staphylococcus aureus strains from children hospitalized in a tertiary care hospital in Mexico. Scandinavian journal of infectious diseases 46(7): 523-
527.

Chambers, H. F. and F. R. DeLeo (2009). Waves of resistance: Staphylococcus aureus in the antibiotic era.Nature Reviews Microbiology 7(9): 629-641.

El-Din, S. A. S., E. El-Shafey, R. Mohamad, M. El-Hadidy, A. El-Din, M. El-Hadidy and H. Zaghloul (2003). Methicillin-resistant Staphylococcus aureus: a problem in the burns unit.” Egyptian Journal of Plastic and Reconstructive Surgery 27: 1-10.

Forbes BA, Sahm DF and W. AS (2007). bailey&scotts Diagnostic microbiology USA, Elsevier.

Francis, J. S., M. C. Doherty, U. Lopatin, C. P. Johnston, G. Sinha, T. Ross, M. Cai, N. N. Hansel, T. Perl and J. R. Ticehurst (2005). Severe community-onset pneumonia in healthy adults caused by methicillin-resistant Staphylococcus aureus carrying the Panton-Valentine leukocidin genes. Clinical Infectious Diseases 40(1): 100-107.

Holmes, A., M. Ganner, S. McGuane, T. Pitt, B. Cookson and A. Kearns (2005). Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: frequency, characterization, and association with clinical disease.Journal of clinical microbiology 43(5): 2384-2390.

Jensen, S. O. and B. R. Lyon (2009). Genetics of antimicrobial resistance in Staphylococcus aureus. Future microbiology 4(5): 565-582.

Khosravi, A. D., H. Hoveizavi and Z. Farshadzadeh (2012). The prevalence of genes encoding leukocidins in Staphylococcus aureus strains resistant and sensitive to methicillin isolated from burn patients in Taleghani hospital, Ahvaz, Iran. Burns 38(2): 247-251.

Kilic, A., A. U. Guclu, Z. Senses, O. Bedir, H. Aydogan and A. C. Basustaoglu (2008). Staphylococcal cassette chromosome mec (SCCmec) characterization and panton-valentine leukocidin gene occurrence for methicillin-resistant Staphylococcus aureus in Turkey, from 2003 to 2006. Antonie Van Leeuwenhoek 94(4): 607-614.

Klein, E., D. L. Smith and R. Laxminarayan (2007). Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999-2005.Emerging infectious diseases 13(12): 1840.

Klevens, R. M., J. R. Edwards, F. C. Tenover, L. C. McDonald, T. Horan, R. Gaynes and N. N. I. S. System (2006). Changes in the epidemiology of methicillin-resistant Staphylococcus aureus in intensive care units in US hospitals, 1992–2003. Clinical infectious diseases 42(3): 389-391.

Kondo, Y., T. Ito, X. X. Ma, S. Watanabe, B. N. Kreiswirth, J. Etienne and K. Hiramatsu (2007). Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions.Antimicrobial Agents and Chemotherapy 51(1): 264-274.

Krziwanek, K., C. Luger, B. Sammer, S. Stumvoll, M. Stammler, S. Metz-Gercek and H. Mittermayer (2007). PVL-positive MRSA in Austria. European Journal of Clinical Microbiology & Infectious Diseases 26(12): 931-935

Kuehnert, M. J., H. A. Hill, B. A. Kupronis, J. I. Tokars, S. L. Solomon and D. B. Jernigan (2005). Methicillin-resistant-Staphylococcus aureus hospitalizations, United States. Emerg Infect Dis 11(6): 868-872.

Lari, A. R., M. R. Pourmand, S. O. Moghadam, Z. Abdossamadi, A. E. Namvar and B. Asghari (2011). Prevalence of PVL-containing MRSA isolates among hospital staff nasal carriers. Laboratory Medicine 42(5): 283-286.

Lina, G., Y. Piémont, F. Godail-Gamot, M. Bes, M.-O. Peter, V. Gauduchon, F. Vandenesch and J. Etienne (1999). Involvement of Panton-Valentine leukocidin—producing Staphylococcus aureus in primary skin infections and pneumonia. Clinical Infectious Diseases 29(5): 1128-1132.

Llarrull, L. I., J. F. Fisher and S. Mobashery (2009). “Molecular basis and phenotype of methicillin resistance in Staphylococcus aureus and insights into new â-lactams that meet the challenge. Antimicrobial agents and chemotherapy 53(10): 4051-4063.

Mariem, B. J.-J., T. Ito, M. Zhang, J. Jin, S. Li, B.-B. B. Ilhem, H. Adnan, X. Han and K. Hiramatsu (2013). Molecular characterization of methicillin-resistant Panton-valentine leukocidin positive Staphylococcus aureus clones disseminating in Tunisian hospitals and in the community. BMC microbiology
13(1): 1.

McClure, J.-A., J. M. Conly, V. Lau, S. Elsayed, T. Louie, W. Hutchins and K. Zhang (2006). Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphylococci. Journal of clinical microbiology 44(3): 1141-1144.

Merlino, J., J. Watson, B. Rose, M. Beard-Pegler, T. Gottlieb, R. Bradbury and C. Harbour (2002). “Detection and expression of methicillin/oxacillin resistance in multidrug-resistant and non-multidrug-resistant Staphylococcus aureus in Central Sydney, Australia.” Journal of Antimicrobial chemotherapy 49(5): 793-801.

Narita, S., J. Kaneko, J.-i. Chiba, Y. Piémont, S. Jarraud, J. Etienne and Y. Kamio (2001). Phage conversion of Panton-Valentine leukocidin in Staphylococcus aureus: molecular analysis of a PVL-converting phage, ϕSLT. Gene 268(1): 195-206.

NIKBAKHT, M., M. Nahaei, M. Akhi, M. Asgharzadeh and S. Nikvash (2007). Nasal carriage rate of Staphylococcus aureus in hospital personnel and inpatients and antibiotic resistance pattern of isolated strains from nasal and clinical specimens in Tabriz.

Sadeghi, J. and S. Mansouri (2014). Molecular characterization and antibiotic resistance of clinical isolates of methicillin‐resistant Staphylococcus aureus obtained from Southeast of Iran (Kerman).Apmis 122(5): 405-411.

Saderi, H., M. Habibi, P. Owlia and M. Asadi Karam (2008). Detection of methicillin resistance in Staphylococcus aureus by disk diffusion and PCR methods. Iranian Journal of Pathology 3(1): 11-14.

Santos, K. R., L. M. Teixeira, G. Leal, L. S. Fonseca and P. Gontijo Filho (1999). “DNA typing of methicillin-resistant Staphylococcus aureus: isolates and factors associated with nosocomial acquisition in two Brazilian university hospitals.” Journal of medical microbiology 48(1): 17-23.

Vandenesch, F., T. Naimi, M. C. Enright, G. Lina, G. R. Nimmo, H. Heffernan, N. Liassine, M. Bes, T. Greenland and M.-E. Reverdy (2003). Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence.” Emerging infectious diseases 9(8): 978-984.

Zamani, A., S. Sadeghian, J. Ghaderkhani, M. Y. Alikhani, M. Najafimosleh, M. T. Goodarzi, H. S. Farahani and R. Yousefi-Mashouf (2007). Detection of methicillin-resistance (mec-A) gene in Staphylococcus aureus strains by PCR and determination of antibiotic susceptibility.” Annals of Microbiology 57(2): 273-276.