Microbiological

Communication

Biosci. Biotech. Res. Comm. 9(4): 615-620 (2016)

Frequency of

pvl

gene in methicillin resistant

Staphylococcus aureus

Isolates collected from

Northwest Iran

N. Javanshir Rezaei

, M R. Nahaei

*, J. Sadeghi

, A. Esmailkhani

1,4

M. Sc. Student, Immunology Research Center, and Department of Microbiology, Faculty of Medicine, Tabriz

University of Medical Sciences, Tabriz, Iran

2,3

Immunology Research Center, and Department of Microbiology, Faculty of Medicine, Tabriz University of

Medical Sciences, Tabriz, Iran

ABSTRACT

Staphylococcus aureus infections, particularly infections caused by methicillin-resistant S. aureus (MRSA) strains,

are emerging as a major public health problem. The aim of the present study was to determine the prevalence of

methicillin-resistant staphylococcus aureus (MRSA) by phenotypic and genotypic methods in clinical specimens and

detection of the Panton – Valentine leukocidin (PVL) gene in the MRSA strains. In an 11-month study, 710 clinical

specimens were collected from patients attending to several teaching hospitals of Urmia city, Northwest Iran. The

isolates were examined by conventional culture method for detecting S. aureus strains and further con rmation with

standard biochemical tests, including catalase, coagulase and DNase. MRSA isolates phenotypically were screened

by disk diffusion method. Then DNA was extracted from our MRSA isolates and mecA gene ampli ed by PCR.

Finally, pvl genes were identi ed among MRSA isolates which were positive for mecA gene. Among test isolates, 114

isolates (16%) were con rmed as S. aureus, from which 48 (42.1%) were recorded as MRSA. pvl gene was detected

in 13 (27%) MRSA isolates. Our study showed that the prevalence of PVL-positive MRSA isolates, justify further

detailed inspection to prevent possible future endemics in the studied hospitals and likewise other hospitals in the

region.

KEY WORDS: MRSA,STAPHYLOCOCCUS AUREUS,

PVL GENE

, MEC A GENE

615

ARTICLE INFORMATION:

*Corresponding Author: nahaeim@yahoo.com

Received 31

Oct, 2016

Accepted after revision 18

Dec, 2016

BBRC Print ISSN: 0974-6455

Online ISSN: 2321-4007

Thomson Reuters ISI ESC and Crossref Indexed Journal

NAAS Journal Score 2015: 3.48 Cosmos IF : 4.006

reserved.

Online Contents Available at: http//www.bbrc.in/

616 FREQUENCY OF

PVL

GENE IN METHICILLIN RESISTANT

STAPHYLOCOCCUS AUREUS

ISOLATES BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Rezaei, Nahaei, Sadeghi and Esmailkhani

INTRODUCTION

Staphylococcus aureus is a Gram-positive opportunis-

tic bacterium of great clinical signi cance, expressing

diverse virulence factors that facilitate its adherence,

colonization, intercellular interaction, immune system

evasion, and tissue damage. Moreover, this microor-

ganism has developed resistance to -lactam antibiot-

ics by -lactamase expression or the presence of peni-

cillin binding protein 2a (PBP2a) directly related with

methicillin-resistant S. aureus (MRSA) strains.The mec

A gene codi es for PBP2a and is a structural part of a

mobile genetic element named Staphylococcal cassette

chromosome mec (SCCmec), which can insert itself into a

speci c region of its central genome. The different types

of SCCmec are classi ed according to the combina-

tion of the mec complex (mecA gene and its regulators)

and the cassette chromosomal recombinase (ccr), which

codi es for enzymes responsible for SCCmec mobility.

Mec A gene is not present in methicillin-sensitive S.

aureus (MSSA) strains and the presence of this gene is

regarded as a criterion of resistance (Merlino, Watson et

al. 2002 Llarrull, Fisher et al. 2009 Chambers and DeLeo

2009 Jensen and Lyon 2009, Borbón-Esquer, Villaseñor-

Sierra et al. 2014).

In 1961 the  rst MRSA strain was identi ed in the

United Kingdom. Especially in the past two decades the

prevalence of these strains have increased in the world

(El-Din, El-Shafey et al. 2003). These strains are usually

associated with hospital-acquired infections (HA-MRSA)

that shows resistance to many antibiotics, including

-lactams, semi-synthetic penicillins, cephalosporins

and carbapenems. The prevalence of HA-MRSA is vari-

able in different parts of the world, ranging from 4.1%

in Panama up to 59% in Korea (Klevens, Edwards et al.

2006, Klein, Smith et al. 2007, Alvarez, Ramirez et al.

2008).

Genotyping of MRSA strains has been employed in

epidemiological studies to determine its prevalence, dis-

semination, risk factors, and association with antimicro-

bial resistance (Kondo, Ito et al. 2007). Production of the

Panton – Valentine leukocidin (PVL) in MRSA strains is

considered to be associated with disease severity (Lina,

Piémont et al. 1999). PVL is a Staphylococcal leukoci-

din which only attacks macrophages and polymorpho-

nuclears, and has two components “S (33kDa)” and “F

(34kDa)” which is controlled by luk S-PV and luk F-PV

genes, respectively (Narita, Kaneko et al. 2001). With

respect to the presence of certain chromosomal cas-

settes, the majority of the published studies have shown

an association of SCCmec type II strains with hospital

infections, whereas type IVa strains, with or without

the presence of the pvl gene, have been associated with

community-acquired infections (Borbón-Esquer, Vil-

laseñor-Sierra et al. 2014).The aim of the present study

was to determine the prevalence of pvl gene in MRSA

isolates by genotypic methods in clinical specimens.

MATERIAL AND METHODS

BACTERIAL ISOLATES

A total of 710 different clinical specimens, including

urine, wound, blood, broncho-alveolar lavage, skin

and soft tissue, cerebrospinal  uid and body  uids

were studied for isolation of S. aureus during January-

December 2015 from patients admitted to several hos-

pitals in Urmia city, West Azerbaijan, Iran. Initially, all

isolates were identi ed using standard microbiological

and laboratory methods, including growth on blood agar

and type of hemolysis, Gram stain, catalase test, growth

on mannitol salt agar, slide and tube coagulase tests,

and DNase test (Forbes et al. 2007). Later, all S. aureus

isolates were stored in nutrient broth supplemented with

15% glycerol at -20°C until use.

PHENOTYPIC DETECTION OF MRSA ISOLATES

Resistance to methicillin was determined by Kirby –

Bauer disk diffusion method on Muller Hinton agar

(MHA) using cefoxitin disk (Hi Media, India) as described

in the guidelines of Clinical and Laboratory Standards

Institute (CLSI) documents . As recommended in the CLSI

guidelines, direct colony suspension method was used

for testing of S. aureus isolates for potential methicillin

and or oxacillin resistance. The plates were incubated at

35°C for 18–24 hours aerobically, and growth inhibition

zones around the disk was measured. Inhibition zone

diameters ≤21 mm considered as resistant. Any visible

growth within the zone of inhibition was also consid-

ered as methicillin resistant.

DNA EXTRACTION

DNA extracti on was performed according to Sadeghi

et al. (Sadeghi and Mansouri 2014). Brie y, for mak-

ing a starter culture, a single colony of S. aureus was

inoculated on nutrient agar. Three or four colonies of

overnight growing bacteria from the starter culture were

suspended in 450 μl of TE (Tris-EDTA) buffer (10 mM

Tris, 1 mM EDTA, pH 8). Cell lysis was obtained by treat-

ment with 5 μl of proteinase K (20 mg/mL) for 20 min

at 50 °C followed by addition of 60 μl of 10% SDS for

10 min at 68 °C. In the next step, 80 μl of cetyltrimeth-

ylammonium bromide (CTAB)/NaCl and 100 μl of 5 M

NaCl were added and incubated at 65 °C for 10 min.

Then, chloroform/isoamyl alchohol (700 μl) was added

and centrifuged at 11000 × g for 8 min. Supernatant was

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS FREQUENCY OF

PVL

GENE IN METHICILLIN RESISTANT

STAPHYLOCOCCUS AUREUS

ISOLATES 617

Rezaei, Nahaei, Sadeghi and Esmailkhani

transferred to another tube and the DNA was precipi-

tated with isopropanol, washed with 70% ethanol, dried,

and dissolved in 100 μl of deionized water.

MOLECULAR DETECTION OF MEC A GENE

All S. aureus isolates were evaluated by PCR ampli -

cation for detection of mecA gene by using mecA P4

(5’-TCCAGATTACAACTTCACCAGG-3’) and mecA P7

(5’- CCACTTCATATC TTGTAACG-3’) primers (McClure,

Conly et al. 2006). PCR performed in a 25μl volume

containing 10 pmol of each primers, 200 μM dNTP

(Roche, Germany), 2.5 μl (50 mM MgCl2), 0.5 μl Taq

polymerase (2.5 u) (Roche, Germany), 5 μl PCR buffer

10x (Roche,Germany) and 5 μl DNA-template. S.aureus

ATCC 33591 and ATCC 25923 were used as positive and

negative controls, respectively. The following PCR con-

dition was used: 94°C (4 min),30 cycles with 94°C (45 s)

,56°C (45 s), 72°C (1 min) and  nally 72°C (7 min) ; 4°C

hold.

MOLECULAR DETECTION OF PVL GENE

PCR for detection of pvl gene was carried out by using

primers as below:

pvl-1:5’ATCATTAGGTAAAATGTCTGGACATGATCCA–3’

and pvl-2: 5’ GCATCAAGTGTATTGGATAGCAAAAGC –

3’ (McClure, Conly et al. 2006). PCR performed in a 50 μl

containing 20 pmol of each primer, 5 μl of 10x buffers,

1.5 μl of dNTP (10pmol), 3 μl of MgCl

and 32.5 μl of

distilled water and 4 μl of the template DNA. DNA dena-

tured for 5 minutes at 95 °C following with 35 cycles of

denaturing performed for 30 S at 92°C, with annealing

at 55 °C for 30 S, extension at 72 °C for 45 S and  nally,

10 minutes of the  nal extension performed at 72 °C.

AGAROSE GEL ELECTROPHORESIS FOR

DETECTION OF PCR PRODUCTS

PCR products were visualized following electrophoresis

in 1.7% agarose gels run at 70 V with ethidium bromide

staining (Sigma, USA). pvl gene and mecA gene posi-

tive isolates yielded an ampli cation product of shining

band in 433 and 162 base pair, respectively, with the

standard positive control under UV trans-illuminator

(UVP, USA) (SANTOS, TEIXEIRA et al. 1999).

STATICAL ANALYSIS

Data were analyzed using SPSS statistical software (ver-

sion 15, SPSS, Chicago, USA), Chi-square exact test was

used to test for signi cant association between cate-

gorical variables. P-value less than 0.05 was considered

signi cant.

RESULTS AND DISCUSSION

Distribution of methicillin resistant S. aureus:

Out of 710 clinical specimens, 114 isolates (16%) were

con rmed as S. aureus, of which 48 (42.1%) were

recorded as methicillin resistant, mostly isolated from

urine, wound discharge and blood (Table1).

Table 1: Distribution of methicillin-resistant

Staphylococcus aureus (MRSA) isolates according to

clinical specimens.

Specimens No. of

S. aureus

isolates (%)

MRSA (%)

Urine 33(28.94) 16(14.03)

Wound 29(25.43) 15(13.15)

Blood 14(12.28) 8(7.01)

Broncho-alveolar lavage 11(9.64) 3(2.63)

Skin and soft tissue 8(7.01) 1(0.87)

Cerebrospinal  uid 7(6.14) 3(2.63)

Body  uids 5(4.38) 1(0.87)

Other specimens 7(6.14) 1(0.87)

Total 114(100) 48(42.1)

Phenotypic detection of methicillin resistant S. aureus

and molecular detection of mecA gene:

The presence of mecA gene using PCR considered as the

gold standard method for calculating the speci city and

sensitivity of the other tests in this study. Results from

conventional disk diffusion susceptibility tests correlated

very well with those from the PCR assay. The cefoxitin

disk detected MRSA isolates correctly in all cases com-

pared to the presence of mecA gene by PCR (42.1%)

(Figure 1). Entirely based on cefoxitin disc results there

was no substantial differences between conventional

susceptibility testing and PCR for calculating methicillin

resistant S. aureus (p>0.05). The overall results obtained

with different techniques are shown in Table 2.

Detection of MRSA isolates carrying pvl gene:

Among MRSA isolates, 13 (27%) contained pvl genes

and the remaining isolates were recorded as pvl negative

(Figure 2).

S. aureus is one of the most common infectious

agents which has become a frequent cause of nosocomial

infection. This bacterium is simply gained and comprises

potential to become resistant to many common in-use

antibiotics and the prevalence of resistant strains pos-

ing serious therapeutic and infection control problems

within the hospital environment (Khosravi, Hoveizavi et

al. 2012). The infections caused by MRSA are important

and can even cause mortality, so increasing antibiotic

618 FREQUENCY OF

PVL

GENE IN METHICILLIN RESISTANT

STAPHYLOCOCCUS AUREUS

ISOLATES BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Rezaei, Nahaei, Sadeghi and Esmailkhani

TABLE 2: Sensitivity and speci city of diagnostic

methods in identi cation of methicillin-resistant S.

aureus.

Test No. of MRSA

identi ed (%)

Sensitivity Speci city

Cefoxitin disk 48(40.67%) 100% 100

mecA 48(40.67%) 100% 100

resistance is a concern and should be monitored (Mer-

lino, Watson et al. 2002).

Approximately 89.4 million persons (32%) and 2.3

million persons (0.8%) of the US population are colo-

nized with S.aureus and MRSA, respectively (Kuehnert,

Hill et al. 2005). The rate of MRSA in all community-

associated S.aureus infections ranges from 2.5% to 39%

in Asian countries (Vandenesch, Naimi et al. 2003). In

our study, 42.1% of isolates were recorded as MRSA,

while other studies conducted in Iran have shown MRSA

prevalence is 55% in Tehran (Saderi, Habibi et al. 2008),

37% in Tabriz (NIKBAKHT, Nahaei et al. 2007) and 50%

in Hamedan (Zamani, Sadeghian et al. 2007).

Such strains can be spread by close contact with an

infected person, touching contaminated surfaces and

stuffs, unhealthy and crowded living conditions and

poor personal hygiene. In addition, MRSA is dif cult

to treat due to multi-drug resistance and cause confu-

sion in the usual sensitivity tests to detect the resist-

ance due to non-uniform expression of them. Therefore,

the detection of mecA and pvl genes represents a quick

and more speci c method for early identi cation of

CA-MRSA isolates (McClure, Conly et al. 2006). Also, a

combination of mecA and pvl genes is capable to pro-

duce super adaptable S. aureus strains (22-25). Most of

CA-MRSA strains have the virulence factor, PVL, which

is not often found in HA-MRSA or MSSA strains. But a

low occurrence of MSSA was reported, and has been led

to necrotizing pneumonia and death (Vandenesch, Naimi

et al. 2003).

In recent years, an impressive worldwide spread of

PVL-positive CA-MRSA clones have been observed

(Francis, Doherty et al. 2005). Out of the MRSA isolates

in our study, 27% carried PVL-encoding genes. Previ-

ous studies in Iran have reported the prevalence to be

19% in the capital of Iran; Tehran (Lari, Pourmand et

al. 2011), 7.23% in the Southwest; Ahvaz (Khosravi,

Hoveizavi et al. 2012), and 5.47% in the South; Shi-

raz (Alfatemi, Motamedifar et al. 2014). In contrast to

the present study, some previous reports have described

an extremely high prevalence of pvl genes in MRSA.

In Western Nepal, Tunisian and Texas, the prevalence

of PVL-positive MRSA isolates was 56.8%, 79%, 94.9%

respectively (Bocchini, Hulten et al. 2006, Mariem, Ito

et al. 2013, Bhatta, Cavaco et al. 2016). Some investiga-

tions revealed a low prevalence of PVL genes in MRSA.

In Turkey, UK and Austria PVL-positive MRSA occur-

rence were detected 1.3%, 1.6%, 3.7%, respectively (Hol-

mes, Ganner et al. 2005, Krziwanek, Luger et al. 2007,

Kilic, Guclu et al. 2008). These  ndings may re ect

the difference in the prevalence of this gene in differ-

ent geographic regions and also kind of assay used for

detecting the genes.

Since there is a strong evidence of involvement of

pvl gene in pathogenesis of S. aureus strains, so diag-

nosis and treatment of infections caused by S. aureus

strains harboring these genes is very important. Detec-

FIGURE 1. PCR products for the

pvl

gene. Lane 1:

100 bp molecular weight marker. Lane 2: Staphy-

lococcus aureus pvl gene-positive control. lanes

3-6: pvl positive Staphylococcus aureus isolates

(433bp).

FIGURE 2. PCR products for the

mecA

gene. Lane

1: 100 bp molecular weight marker. Lane2: Posi-

tive control (MRSA). Lanes 3, 4 and 6: mecA posi-

tive Staphylococcus aureus isolates (162bp). Lane 5:

Negative control.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS FREQUENCY OF

PVL

GENE IN METHICILLIN RESISTANT

STAPHYLOCOCCUS AUREUS

ISOLATES 619

Rezaei, Nahaei, Sadeghi and Esmailkhani

tion of PVL is commonly carried out by using molecular

techniques (Khosravi, Hoveizavi et al. 2012). Accord-

ing to the results of this study, the phenotypic methods

with cefoxitin susceptibility testing and PCR assay for

MRSA gene can be useful for de nite diagnosis of MRSA

strains. Our study was limited because SCCmec typing

was not performed.

CONCLUSION

In conclusion, the prevalence of PVL-positive MRSA

isolates, found to be 27% in this study, justify further

detailed inspection to prevent possible future endemics

in the studied hospitals and likewise other hospitals in

the region.

Moreover, if these strains spread to parts of

hospital, including pediatrics, intensive care and cardiac

intensive care unit could be life threating. Therefore,

identi cation of these strains and treatment of relative

infections is important in prevention of colonization

and spread.

ACKNOWLEDGMENT

The authors are grateful to Immunology Research Center

of Tabriz University of Medical Sciences for supporting

this study to be undertaken.

REFERENCES

Clinical and Laboratory Standards Institute/NCCLS (2005). Per-

formance Standards for Antimicrobial Susceptibility Testing;

Fifteenth Informational Supplement. CLSI/ NCCLS documents

M100-S15. USA.

Alfatemi, S. M. H., M. Motamedifar, N. Hadi and H. S. E. Saraie

(2014). Analysis of virulence genes among methicillin resistant

Staphylococcus aureus (MRSA) strains. Jundishapur journal of

microbiology 7(6).

Alvarez, J., A. Ramirez, M. Mojica-Larrea, J. R. Huerta, J.

Guerrero, A. Rolon, H. Medina, J. Munoz, J. Mosqueda and A.

Macias (2008). [Methicillin-resistant Staphylococcus aureus at

a general hospital: epidemiological overview between 2000-

2007]. Revista de investigacion clinica; organo del Hospital de

Enfermedades de la Nutricion 61(2): 98-103.

Bhatta, D. R., L. M. Cavaco, G. Nath, K. Kumar, A. Gaur, S.

Gokhale and D. R. Bhatta (2016). Association of Panton Valen-

tine Leukocidin (PVL) genes with methicillin resistant Staphy-

lococcus aureus (MRSA) in Western Nepal: a matter of concern

for community infections (a hospital based prospective study).

BMC infectious diseases 16(1): 1.

Bocchini, C. E., K. G. Hulten, E. O. Mason, B. E. Gonzalez, W. A.

Hammerman and S. L. Kaplan (2006). Panton-Valentine leukoci-

din genes are associated with enhanced in ammatory response

and local disease in acute hematogenous Staphylococcus aureus

osteomyelitis in children. Pediatrics 117(2): 433-440.

Borbón-Esquer, E. M., A. Villaseñor-Sierra, E. Martínez-

López, J. J. Jáuregui-Lomeli, R. Villaseñor-Martínez and M.

d. R. Ruiz-Briseño (2014). SCC mec types and pvl gene in

methicillin-resistant Staphylococcus aureus strains from

children hospitalized in a tertiary care hospital in Mexico.

Scandinavian journal of infectious diseases 46(7): 523-

527.

Chambers , H. F. and F. R. DeLeo (2009). Waves of resistance:

Staphylococcus aureus in the antibiotic era.Nature Reviews

Microbiology 7(9): 629-641.

El-Din, S. A. S., E. El-Shafey, R. Mohamad, M. El-Hadidy, A.

El-Din, M. El-Hadidy and H. Zaghloul (2003). Methicillin-

resistant Staphylococcus aureus: a problem in the burns unit.”

Egyptian Journal of Plastic and Reconstructive Surgery 27:

1-10.

Forbes B A, Sahm DF and W. AS (2007). bailey&scotts Diagnos-

tic microbiology USA, Elsevier.

Francis, J. S., M. C. Doherty, U. Lopatin, C. P. Johnston, G.

Sinha, T. Ross, M. Cai, N. N. Hansel, T. Perl and J. R. Ticehurst

(2005). Severe community-onset pneumonia in healthy adults

caused by methicillin-resistant Staphylococcus aureus carry-

ing the Panton-Valentine leukocidin genes. Clinical Infectious

Diseases 40(1): 100-107.

Holmes, A., M. Ganner, S. McGuane, T. Pitt, B. Cookson and

A. Kearns (2005). Staphylococcus aureus isolates carrying

Panton-Valentine leucocidin genes in England and Wales: fre-

quency, characterization, and association with clinical disease.

Journal of clinical microbiology 43(5): 2384-2390.

Jensen, S. O. and B. R. Lyon (2009). Genetics of antimicrobial

resistance in Staphylococcus aureus. Future microbiology 4(5):

565-582.

Khosravi , A. D., H. Hoveizavi and Z. Farshadzadeh (2012). The

prevalence of genes encoding leukocidins in Staphylococcus

aureus strains resistant and sensitive to methicillin isolated

from burn patients in Taleghani hospital, Ahvaz, Iran. Burns

38(2): 247-251.

Kilic, A ., A. U. Guclu, Z. Senses, O. Bedir, H. Aydogan and

A. C. Basustaoglu (2008). Staphylococcal cassette chromosome

mec (SCCmec) characterization and panton-valentine leukoci-

din gene occurrence for methicillin-resistant Staphylococcus

aureus in Turkey, from 2003 to 2006. Antonie Van Leeuwen-

hoek 94(4): 607-614.

Klein, E ., D. L. Smith and R. Laxminarayan (2007). Hospitali-

zations and deaths caused by methicillin-resistant Staphylo-

coccus aureus, United States, 1999-2005.Emerging infectious

diseases 13(12): 1840.

Klevens, R. M., J. R. Edwards, F. C. Tenover, L. C. McDonald, T.

Horan, R. Gaynes and N. N. I. S. System (2006). Changes in the

epidemiology of methicillin-resistant Staphylococcus aureus

in intensive care units in US hospitals, 1992–2003. Clinical

infectious diseases 42(3): 389-391.

Kondo, Y ., T. Ito, X. X. Ma, S. Watanabe, B. N. Kreiswirth,

J. Etienne and K. Hiramatsu (2007). Combination of multi-

plex PCRs for staphylococcal cassette chromosome mec type

assignment: rapid identi cation system for mec, ccr, and major

Rezaei, Nahaei, Sadeghi and Esmailkhani

620 FREQUENCY OF

PVL

GENE IN METHICILLIN RESISTANT

STAPHYLOCOCCUS AUREUS

ISOLATES BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

differences in junkyard regions.Antimicrobial Agents and

Chemotherapy 51(1): 264-274.

Krziwane k, K., C. Luger, B. Sammer, S. Stumvoll, M. Stammler,

S. Metz-Gercek and H. Mittermayer (2007). PVL-positive MRSA

in Austria. European Journal of Clinical Microbiology & Infec-

tious Diseases 26(12): 931-935

Kuehnert , M. J., H. A. Hill, B. A. Kupronis, J. I. Tokars, S. L.

Solomon and D. B. Jernigan (2005). Methicillin-resistant-

Staphylococcus aureus hospitalizations, United States. Emerg

Infect Dis 11(6): 868-872.

Lari, A. R., M. R. Pourmand, S. O. Moghadam, Z. Abdossa-

madi, A. E. Namvar and B. Asghari (2011). Prevalence of PVL-

containing MRSA isolates among hospital staff nasal carriers.

Laboratory Medicine 42(5): 283-286.

Lina, G. , Y. Piémont, F. Godail-Gamot, M. Bes, M.-O. Peter,

V. Gauduchon, F. Vandenesch and J. Etienne (1999). Involve-

ment of Panton-Valentine leukocidin—producing Staphylococ-

cus aureus in primary skin infections and pneumonia. Clinical

Infectious Diseases 29(5): 1128-1132.

Llarrull, L. I., J. F. Fisher and S. Mobashery (2009). “Molecular

basis and phenotype of methicillin resistance in Staphylococ-

cus aureus and insights into new -lactams that meet the chal-

lenge. Antimicrobial agents and chemotherapy 53(10): 4051-

4063.

Mariem, B. J.-J., T. Ito, M. Zhang, J. Jin, S. Li, B.-B. B. Ilhem,

H. Adnan, X. Han and K. Hiramatsu (2013). Molecular char-

acterization of methicillin-resistant Panton-valentine leuko-

cidin positive Staphylococcus aureus clones disseminating in

Tunisian hospitals and in the community. BMC microbiology

13(1): 1.

McClure, J .-A., J. M. Conly, V. Lau, S. Elsayed, T. Louie, W.

Hutchins and K. Zhang (2006). Novel multiplex PCR assay

for detection of the staphylococcal virulence marker Panton-

Valentine leukocidin genes and simultaneous discrimination of

methicillin-susceptible from-resistant staphylococci. Journal

of clinical microbiology 44(3): 1141-1144.

Merlino, J ., J. Watson, B. Rose, M. Beard-Pegler, T. Gottlieb,

R. Bradbury and C. Harbour (2002). “Detection and expres-

sion of methicillin/oxacillin resistance in multidrug-resistant

and non-multidrug-resistant Staphylococcus aureus in Central

Sydney, Australia.” Journal of Antimicrobial chemotherapy

49(5): 793-801.

Narita, S. , J. Kaneko, J.-i. Chiba, Y. Piémont, S. Jarraud, J.

Etienne and Y. Kamio (2001). Phage conversion of Panton-Val-

entine leukocidin in Staphylococcus aureus: molecular analy-

sis of a PVL-converting phage, SLT. Gene 268(1): 195-206.

NIKBAKHT, M. , M. Nahaei, M. Akhi, M. Asgharzadeh and S.

Nikvash (2007). Nasal carriage rate of Staphylococcus aureus

in hospital personnel and inpatients and antibiotic resistance

pattern of isolated strains from nasal and clinical specimens

in Tabriz.

Sadeghi, J. and S. Mansouri (2014). Molecular characteriza-

tion and antibiotic resistance of clinical isolates of methicil-

lin‐resistant Staphylococcus aureus obtained from Southeast

of Iran (Kerman).Apmis 122(5): 405-411.

Saderi, H., M . Habibi, P. Owlia and M. Asadi Karam (2008).

Detection of methicillin resistance in Staphylococcus aureus by

disk diffusion and PCR methods. Iranian Journal of Pathology

3(1): 11-14.

Santos, K. R. , L. M. Teixeira, G. Leal, L. S. Fonseca and P. Gon-

tijo Filho (1999). “DNA typing of methicillin-resistant Staphy-

lococcus aureus: isolates and factors associated with nosoco-

mial acquisition in two Brazilian university hospitals.” Journal

of medical microbiology 48(1): 17-23.

Vandenesch, F ., T. Naimi, M. C. Enright, G. Lina, G. R. Nimmo,

H. Heffernan, N. Liassine, M. Bes, T. Greenland and M.-E.

Reverdy (2003). Community-acquired methicillin-resistant

Staphylococcus aureus carrying Panton-Valentine leukocidin

genes: worldwide emergence.” Emerging infectious diseases

9(8): 978-984.

Zamani, A., S . Sadeghian, J. Ghaderkhani, M. Y. Alikhani, M.

Naja mosleh, M. T. Goodarzi, H. S. Farahani and R. Youse -

Mashouf (2007). Detection of methicillin-resistance (mec-A)

gene in Staphylococcus aureus strains by PCR and determina-

tion of antibiotic susceptibility.” Annals of Microbiology 57(2):

273-276.