Biotechnological

Communication

Biosci. Biotech. Res. Comm. 9(3): 357-365 (2016)

Site-directed mutagenesis and thermal stability

analysis of phytase from

Escherichia coli

Jie Zhang*

, Yue Liu

, Shuping Gao

, Li Zhu

, Wei Li

, Xuewen Tian

and

Yuanyuan Liu

Key Laboratory of Biomedical Engineering & Technology of Shandong High School, Shandong Wanjie

Medical College, Zibo, 255213, China

Sports Science Research Center of Shandong Province, Jinan, 250102, China

School of Nursing, Weifang Medical University, Weifang, 261042, China

ABSTRACT

This study aims to obtain a phytase with thermal stability and acid resistance for potential industrial production.

The phytase gene appA was optimized according to Pichia pastoris and modi ed by site-directed mutagenesis,

which replaces speci c residues with another amino acid. Escherichia coli DH5 cells (cultured at 37 °C in Luria

broth media) were the host strain for recombinant DNA manipulation. P. pastoris GS115 and the plasmid pPIC9 were

the host strain and expression vector, respectively, for heterologous phytase gene expression. Through site-directed

mutagenesis, we obtained six mutants, namely, M1, C2, K24E, K43E, M2, and M4 of which the mutants M2 and M4

maintained higher activity in a wider reaction temperature range than other mutants. The mutants M1 and K24E

showed strong thermostability and retained more than 60% activity after heat treatment for 20 min (even at 90 °C).

We screened mutants that expressed phytase, which can withstand the high-temperature feed pelleting process and

retain a high level of phytase activity at the low pH of the monogastric gut environment.

KEY WORDS: PHYTASE; DESIGNATED MUTATIONS; THERMAL STABILITY;

ESCHERICHIA COLI

357

ARTICLE INFORMATION:

*Corresponding Author: wqlzq@gmail.com

Received 2

Sep, 2016

Accepted after revision 25

Sep, 2016

BBRC Print ISSN: 0974-6455

Online ISSN: 2321-4007

Thomson Reuters ISI ESC and Crossref Indexed Journal

NAAS Journal Score 2015: 3.48 Cosmos IF : 4.006

reserved.

Online Contents Available at: http//www.bbrc.in/

IN TRODUCTION

Phytases (myo -inositol-hexaphosphate phosphohy-

drolase) catalyze the hydrolysis of phytate, the major

form of phosphorus storage in cereals and legumes

(Pandee, et al., 2011), into inositol and phosphoric acid

in a stepwise manner (Greiner, et al., 2001, Kim, et al.,

2008), thus increasing the available phosphorus con-

tent and decreasing the af nity of phytate to minerals

and proteins (Pandee, et al., 2011, Zhang, et al., 2007).

358 MUTATION AND PHYTASE THERMAL STABILITY FROM

ESCHERICHIA COLI

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Jie Zhang et al.

The addition of phytase in animal feed could not only

improve the utilization rate of phytate phosphorus in

feed efﬁciently but also signi cantly reduce the envi-

ronmental pollution from phytate phosphorus excreted

by swine and poultry, (Haefner, et al., 2005, Leytem, et

al., 2008and Kim, et al., 2010).Research on phytases has

recently focused on its application to human food and

the synthesis of lower inositol phosphates (Guerrero-

Olazaran, et al., 2010). Commercially produced phytases

are currently used worldwide. However, one of the prob-

lems that phytase still faces is its poor thermal stabil-

ity. Heat resistance of the phytase enzymes are desirable

during the pelleting process of phytase additives, which

can allow it to withstand high temperatures of 60 °C to

95 °C lasting at least 30 s, (Pandee, et al., 2011).

However, this characteristic is rarely found among

naturally occurring sources (Zhang, et al., 2007). There-

fore, site-directed mutagenesis (Kim, et al., 2008, Tran,

et al., 2011), error-prone PCR (Liao, et al., 2012), DNA

shuf ing, exon shuf ing, stagger extension processes

(Zhu, et al., 2010), and substituting residues (Zhang, et

al., 2007) have been used to enhance the thermal stabil-

ity of phytase.Phytases are diffusely distributed among

plants, animal tissues, and microorganisms (Guerrero-

Olazaran, et al., 2010, Liao, et al., 2012).

The most prevalent phytases are from bacteria, yeast,

and fungi (Liao, et al., 2012). Among many phytases,

Escherichia coli phytase AppA as a bifunctional enzyme

(Greiner, et al., 1993) has a great potential for indus-

trial applications due to its wide range of active acid

pH, high speci c activity for phytate, and resistance to

pepsin digestion (Greiner, et al., 1993, Luo, et al., 2007).

Thus, the product of the appA gene was chosen as a can-

didate to enhance the thermal stability of phytase and to

promote the residual activity of phytase during the pel-

leting process, which can reach temperatures as high as

70 °C to 90 °C (Zhang, et al., 2007). The phytase gene has

1233 bp and the protein it encodes has 410 amino acids.

The deduced amino acid sequence of appA contains an

RHGXRXP motif in the N-terminal and HD motif in the

C-terminal, which are characteristics in common with

histidine acid phosphatases, (Kim, et al., 2006, Pandee,

et al., 2011, Yao, et al., 2012, Fan, et al., 2013 and Roy,

et al., 2016).

Pich ia pastoris is a euka ryotic expression system that

was proposed in the 1980s and has since been widely

used for the production of various recombinant heter-

ogeneous proteins (Chang, 2008). By 2005, P. pastoris

had been used to successfully express more than 500

exogenous proteins (Cereghino, et al., 2000), many of

which had reached 10 mg·m L

−1

(Cregg, et al., 2000). As

one of the most ideal exogenous protein expression sys-

tems, P. pastoris has the advantage of being simple to

operate, being highly stable, having high expression lev-

els, and having large quantities of secretion (Li, et al.,

2001).

Based on the previous reports of enhancing the ther-

mal stability of phytase, (Kim, et al., 2008, Zhang, et al.,

2007, Zhu, et al., 2010, Liao, et al., 2012, Tran, et al.,

2011, Noorbatcha, et al., 2013, Rocky-Salimi, et al., 2016

and Tan et al., 2016), we chose six amino acid residues

sites which maybe change thermal stability by chang-

ing residual charge. In this study, phytase gene appA

was optimized according to P. pastoris and was modi ed

by site-directed mutagenesis. Site-directed mutagenesis

of the cloned appA gene was used to replace speci c

residues with another amino acid. The mutant genes

were expressed in P. pastoris GS115, and the recombi-

nant phytases were subjected to detailed assays of their

thermostability, pH dependence of enzyme activity, and

their Michaelis constant. The biochemical characteristics

of these recombinant phytases were compared to obtain

a phytase with excellent quality, which may have poten-

tial for industrial production.

MATERIAL AND METHODS

E. coli DH5 c ells (TaKaRa, Japan) were the host strain

for recombinant DNA manipulation and were cultured

at 37 °C in Luria broth media. P. pastoris GS115 and the

plasmid pPIC9 (Invitrogen, USA) was the host strain and

expression vector, respectively, for heterologous phytase

gene expression. Plasmid vector pGEM-T Easy (Promega,

USA) containing a fusion gene of the syntheti c phytase

gene appA and the synthetic signal peptide (designated

MF4I; maintained in our laboratory) was used as a PCR

template for site-directed mutagenesis. Oligonucleotide

primers for gene cloning and site-directed mutagenesis

were designed and synthesized by TaKaRa (Japan).

The phytate substrate (sodium salt, P0109) was pur-

chased from Sigma (USA). EcoRI, NotI, BamHI, BglII, Taq

DNA polymerase, T

ligase, a nd dNTP were purchased

from Promega (USA). Yeast extract–peptone–dextrose

medium, minimal dextrose (MD) medium, buffered glyc-

erol complex (BMGY) medium, and buffered methanol

complex (BMMY) medium were prepared according to

the P. pastoris Expression Kit manual (Invitrogen 2002).

All other chemicals were of analytical grade and were

commercially available.

SITE-DIR ECTED MUTAGENESIS

Double-stranded methylat ed plasmid pGEM-T E asy con-

taining the appA gene was utilized to encode the mutant

phytases. Six pairs of complementary primers (Table 1)

containing the desired point mutation were employed

to genera te the necessary mutants (K24E, K43E, W46E,

Q62W, A73P, and K75C). The many mutants of Citrobac-

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS MUTATION AND PHYTASE THERMAL STABILITY FROM

ESCHERICHIA COLI

359

Jie Zhang et al.

ter braakii phytase in Patent PCT/EP2011/054639 were

analyzed, and the part of the same site also generated

in phytase AppA to know their effect on Escherichia

coli phytase. The mutagenesis primers were extended

by PrimeSTAR®HS DNA polymerase in a thermocycling

process (94 °C for 4 min, 20 cycles at 94 °C for 10 s,

55 °C for 15 s, and 72 °C for 4 min). The product was

treated with DpnI at 37 °C for 1 h to remove methylated

and hemimethylated DNA template strands. The nicked

plasmid DNA containing the desired mutations was then

conveyed into E. coli DH5 cells, where the nick was

repaired by the cell.

CONSTRUCTION OF EXPRESSION VECTOR

Expression vectors pPIC9-appAm(X) were constituted by

digesting the recombinant plasmids pGEM-T Easy con-

taining mutant genes with NotI-EcoRI and EcoRI-BamHI,

respectively, obtaining appA

(X) and the synthetic sig-

nal peptide, and then inserting it into pPIC9 (Invitrogen)

digested with NotI-BamHI. The recombinant plasmids

pPIC9-appA

(X) were linearized with BglII and transformed

into P. pastoris GS115 (In vitrogen) using a LiCl method.

SC REENING AND EXPRESSION

The transformants were screened using SDS-PAGE and

the phytase activity assay. After being grown on the MD

plate and cultured in BMGY/BMMY medium at 30 °C,

six positive tr ansformants containing different muta-

tions were successfully obtained (M1, K24E, K43E, C2,

M2, and M4). To generate the enzyme, P. pastoris GS115

was c ultivated at 30 ° C, 200 rp m, and pH 6.0 in 50 mL

BMGY for pr oliferation in an Erlenmeyer  ask for 48

h; P. pastoris GS115 was then cultivated at 30 °C, 200

rpm, and pH 6.0 in 50 mL BMMY for the expression of

phytases in an Erlenmeyer  ask for 48 h.

PU RIFICATION O F RECOMBINANT PHYTASES

Purifying the re combinant proteins involves the precipi-

tation of ammonium sulfate followed by two chroma-

tographic steps. Ammonium sulfate precipitation of the

recombinant proteins was achieved by  rst saturating

the crude culture  ltrate to 80%; th e p recipitate is sub-

sequently collected by centrifugation and concentrated

at a speed of 10,000 rpm for 10 min. The precipitate was

subsequently dissolved in ac etate buffer (pH 4.5). The

traces of ammonium sulfate in the resuspended phytase

solution were removed by dialysis (2 h, three acetate

buffer washings).

A 1 mL Resource S column was equilibrated in

the a cetate buffer, and the dialyzed pr otein samples

were applied at a  ow rate of 0.6 mg·mL

−1

. A linear

sodium chloride gradient (0.2–1.0 M) was developed

in 10 min by using the same buffer. The activity was

eluted as a single component. In the  nal chromato-

graphic step, samples from the previous step were passed

through the Superdex 75 column at a  ow rate of 0.6

mg·mL

−1

. Activity was eluted as a single peak (at peak),

and the active fractions were pooled in the following

test.

ENZYME ACTIVITY ASSAY

Phytase activity was assayed using the molybdenum

blue method. The enzyme reaction was performed in 1

mL of 0.1 M sodium acetate buffer using sodium phytate

(6.25 mM) as a substrate at 37 °C. The reaction was ter-

minated by adding 1 mL of 10% (w/v) trichloroacetic

acid. One unit of phytase activity was de ned as the

amount of enzyme required to liberate 1 μmol of phos-

phate per minute under assay conditions. Protein was

quanti ed using the BCA assay (Fermentas). All deter-

minations were performed three times.

Table 1: Pr imers used for site-directed mutagenesis

Primer Name Primer Sequence (5’3’)

AppA (W46E)-Reverse CCTCTAGGTGTCAACTCACCCAGCTTGACTGGC

AppA (W46E)-Forward GCCAGTCAAGCTGGGTGAGTTGACACCTAGAGG

AppA (Q62W)-Reverse GCAACAAGACGCTGTCTCCAGTAGTGAC

AppA (Q62W)-Forward GTCACTACTGGAGACAGCGTCTTGTTGC

AppA (A73P)-Reverse GTGGACAACCCTTCTTGGGCAACAATCC

AppA (A73P)-Forward GGATTGTTGCCCAAGAAGGGTTGTCCAC

AppA (K75C)-Reverse GATTGTGGACAACCACACTTGGGCAACAATCC

AppA (K75C)-Forward GGATTGTTGCCCAAGTGTGGTTGTCCACAATC

AppA (K24E)-Reverse GTTGGGTGGCCTCGGTTGGTGCTCTAAC

AppA (K24E)-Forward GTTAGAGCACCAACC GAGGCCACCCAAC

AppA (K43E)-Reverse CAACCCAGCTCGACTGGCCAGGTTG

AppA (K43E)-Forward CAACCTGGCCAGTCGAGCTGGGTTG

360 MUTATION AND PHYTASE THERMAL STABILITY FROM

ESCHERICHIA COLI

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Jie Zhang et al.

OPTIMUM PH AND PH STABILITY

The optimum pH was determined by incubating the

puri ed phytase with sodium phytate in the following

buffers: pH 2.0–3.5 (0.05 M glycine-HCl), pH 4.0–6.0

(0.05 M sodium a cetate-acetic acid), and pH 6.5–8.0

(0.05 M Tris-HCl). These assays were performed at 37

°C for 5 min. For assays o f pH stability, the enzy me was

incubated at 37 °C in the same buffers over the range

of pH 2.0–8.0 for 2 h, and residual enzyme activity was

measured under standard conditions (optimum pH, 37

°C, 30 min).

OPTIMUM TEMPERATURE AND THERMAL

STABILITY

Enzyme activity was measured at nine differen t tem-

peratures ranging from 37–80°C to determine optimal

temperature. The temperatures chosen were 37, 40, 45,

50, 55, 60, 65, 70, and 80 °C. The tests were performed

using standard buffers. Thermal stability was measured

by assessing residual enzyme activity under standard

conditions (optimum pH, 37 °C, 30 min) followin g incu-

bation of the enzyme at six different temperatures. The

enzyme s amples were incubate d at 37, 50, 60, 70, 80, or

90 °C for 20 min, respectively. The enzyme samples were

then chilled on melting ice for 1 h before the test.

KINETIC MEASUREMENTS

max

and K

values for each phytase were determined at

37 °C in 0.05 M sodium acetate (pH 4.0 to 4.5, according

to the optimum pH of each enzyme) with 0.125–5.0 mM

sodium phytate as substrate. The initial reaction rates

were assayed for a 7 min period. The V

max

and K

were

estimated by Lineweaver–Burk plots.

STRUCTUR AL ANALYSIS OF MUTAN T PHYTASE

Basing on the crystal structur e of phytase AppA (Golo-

van, et al., 2000), structure analysis was applied to the

mutant that showed the most pot ential as a phytase-

producing strain. Three-dimensional structure predic-

tion was done using the program Swiss-PdbViewer 3.7.

RESULTS AND DISCUSSION

SITE-DIR ECTED MUTAGENESIS AND

CONSTRUCTION OF EXPRESSION VECTOR

Using a site-directed mutagenesis method, a total of six

mutants were obtained, including four single mutants

(K24E, K43E, W46E, and Q62W), one double mutant

(W46E and Q72W), and one quadruple mutant (W46E,

Q62W, A73P, and K75C; Table 2). Mutants were gener-

ated by introducing residual substitutions (K24E, K43E,

W46E, Q62W, A73P, and K75C) into the previously syn-

thetic phytase gene appA. The names of the mutants,

including the mutant sites, are presented in Table 2. The

designated mutations in each variant were veri ed by

DNA sequencing.

SCREENING AND EXPRESSION

The genes coding the protein without a native signal

sequence were inserted into vector pPIC9. Similar to

homologous recombination, the mutant genes with the

signal sequence of yeast -mating factor were inte-

grated into the genome of P. pastoris so that proteins

could be expressed s tably. After transforming the result-

ant recombinant plasmids, six p ositive transformants

that expressed phytase were screened by phytase activ-

ity assay and SDS-PAGE. The positive transformant

for each mutant, which was grown on the MD plate,

was transferred to BMGY and proliferated in an Erlen-

meyer  ask for 48 h. After continuous cultivation in

BMMY for 48 h, the supernatant protein had reached

1.0–1.3 mg·mL

−1

. The crude enzyme solution was pro-

duced after centrifuging supernatant protein in the cul-

ture medium (10,000 g for 10 min). The crude enzyme

solution of recombinant proteins from M1, C2, K24E,

K43E, M2, and M4 were  nally obtained using the same

method.

PURIFICATION OF RECOMBINANT PHYTASES

The phytases obtained from the supernatants were pur i-

 ed to homogeneity by ammonium sulfate precipitation,

anion exchange chromatography, and gel  ltration on

Superdex 75 column ( Fig. 1). Only one peak with high

phytase activity was obtained when samples were chro-

matographed on gel  ltration. After three puri cation

steps, the recombinant proteins were puri ed 28.6-fold

from the crude extract with a  nal yield of 17%. The

puri cation factor and yield are related to elution pro-

cedure (Zhang, et al., 2010). The puri cation scheme of

the phytase is summarized in Table 3.

Table 2: Name of the mutant

including the mutant site

Name Mutant site

M1 W46E

C2 Q62W

K24E K24E

K43E K43E

M2 W46E, Q62W

M4 W46E, Q62W, A73P, K75C

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS MUTATION AND PHYTASE THERMAL STABILITY FROM

ESCHERICHIA COLI

361

Jie Zhang et al.

OPTIMUM PH AND PH STABILITY

As shown in Fig. 2a, the optimal reaction pH for the

mutant K24E was 4.0, whereas that of WT and other

mutant phytas es was 4.5. All phytase activities showed

one sharp peak at the optimal pH, and the relative activ-

ities of the phytases decreased signi cantly when the

pH value exceeded the optimal pH. After incubating in

the same buffer s ystem at different pH levels for 2 h,

the enzymes were puri ed and t he phytase activity was

tested under standard conditions (o ptimum pH, 37 °C,

30 min). The effects of pH on the stability of phytase

are shown in Fig. 2b. P hytase AppA and its mutants had

excellent pH stability (except for mutants K43E and C2),

and a fter incubation at 37 °C in different buffers ranging

from pH 2.0 to 8.0 for 2 h, the r esidual enzyme activity

was kept above 80%. A buffer of pH 2.0 or pH 8.0 might

not affect the enzyme activity signi cantly, but for the

mutants C2 and K43E, enzyme activity residue was less

than 30% after incubating with buffer of pH 8.0.

A: Optimal reaction pH of Mutant K24E is a round

4.0; Optimal reaction pH of AppA and other mutants

(M1, C2, M2, M4 and K43E) is a round 4.5. The every

assay value was averaged from three different experi-

ments. B: Except for mutant K43E and C2, Phytase appA

and mutants (M1, M2, M4 and K43E) all had a pH stabil-

ity and maintained more than 80% enzymatic activity

after 2 hours when they were place in pH 2.0-8.0 buffer

solution except for K43E and C2. The every assay value

was averaged from three different experiments.

OPTIMUM TEMPERATURE AND THER MAL

STABILITY

The opti mal reac tion temperature was 60 °C for the

mutants M1, C2, K24E, and K43E as well as for the

phytase AppA; however, the optimal temperature was

65 °C for the mutants M2 and M4. For the muta nts

M1, C2, K24E, and K43E, and the phytase AppA, the

enzyme activity decreased signi cantly when the reac-

tion temperature was lower than 55 °C or higher than

60 °C. For the mutants M2 and M4, the enzyme activ-

ity decreased distinctly when the reaction temperature

was lower or higher than 65 °C. As shown in Fig. 3,

the mutants M2 and M4 maintained higher activity

at a wider reaction temperature range than any other

mutants (M1, C2, K24E, or K43E) including the wild-

type phytase AppA. The phytase activity of wild -type

Table 3: Puri cation scheme of phytase

Step Total

activities

(/U·mL−1)

Total protein

(m/mg)

Speci c activity

(/U·mg−1)

Puri cation

(fold)

Recovery

(%)

Crude enzymes 93,866 19.56 4800 1 100

(NH

)

(80%) 91,096 11.16 8157 1.7 97

Resource S 4561 1.53 27,818 5.8 46

Superdex-75 17,486 0.13 134,508 28.6 17

The every assay value was averaged from three different experiments.

FIGURE 1: Puri cation and SDS-PAGE of phytase A: Puri cation of phytase

with the Sephdex G-75 gel chromatogram; B: Lane 1: M1; Lane 2: K24E;

Lane 3: K43E Lane 4:C2; Lane 5: M2; Lane 6: M4 Lane 7: phytase AppA.

Jie Zhang et al.

362 MUTATION AND PHYTASE THERMAL STABILITY FROM

ESCHERICHIA COLI

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

AppA decr eased sharply when inc ubated at 50 °C for

20 min, and when inc ubated at 70, 80, or 90 °C for 20

min, the phytase activity practically did not exist. Fur-

thermore, the mutant phytases exhibited improved ther-

mostability compared with AppA. The phytase acti vity

remained above 30% after heat treatment at 70, 80, to

90 °C for 20 min, among which the mutants M1 and

K24E showed strong thermostability and retained more

than 60% activity after heat treatment for 20 min even

at 90 °C.

A: Optimal reaction temperature of phytase AppA

mutants (M2 and M4) is a round 65 °C; AppA and other

mutant is a round 60 °C. The every assay value was

averaged from three different experiments. B: The activ-

ity of phytase AppA decreased by 50% under 60 °C for

20 minutes and was almost entirely lost under 70 °C,

80 °C and 90 °C for 20 minutes; mutant K43E and C2

decreased by 70% under 90 °C for 20 minutes; mutant

M1, M2, M4 and K24E decreased by 40% under 80 °C for

20 minutes. The every assay value was averaged from

three different experiments.

KINETIC MEASUREMENTS

Under standard conditions (optimum pH, 37 °C, 7 min),

the K

and V

max

values of WT enzymes and its mutants

were calculated using sodium phytate as the substrate

and based on the Lineweaver–Burk method (see Table

4). As indicated in Table 4, the K

and V

max

of AppA

were 0.45 mM·L

−1

and 3.85 mmol·m

−1

·mg

−1

, r espec-

tively, whereas the K

of mutant K24E was 0.32 mM·L

−1

which was the lowest, and the V

max

of K24E was 4.10

mmol·(m·mg)

−1

, which was the highest. This  nding

indicated that K2 4E has the most af nity and the most

catalytic ef ciency to sodium phytate.

STRUCTURAL ANALYSIS OF MUTANT PHYTASE

An analysis of all the previous experimental results and

data shows that the mutant K24E outstrips all the other

mutants because of its low optimal reaction pH and high

optimal reaction temperature, preferable pH stability,

and outstanding thermostability. Therefore, the mutant

K24E was chosen to demonstrate structural analysis by

using 3D conformation. Using SWISS-MODEL protein

data analysis (template: 1dkq.1.A), the three-dimen-

sional conformations of mutant K24E and AppA were

found to have the same structure, and their structural

domains and active sites were not different. As shown

in Fig. 4, the crystal structure of AppA consisted of an

-helix, a -sheet, and an irregular coil. In addition, a

deep concave pocket harboring the active enzyme site

FIGURE 2: Optimal reaction pH and pH stability of phytase AppA and its mutants

FIGURE 3: Optimal reaction temperature and thermal stability of phytase AppA

and its mutants.

Jie Zhang et al.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS MUTATION AND PHYTASE THERMAL STABILITY FROM

ESCHERICHIA COLI

363

within the surface of the domains was found. Ly s24 sub-

stituted by Glu was proximal to the concave pocket and

was located at the surface region of the pocket struc-

ture’s edge and was close to the active center site.

Some research con rmed that Escherichia coli AppA

phytase’s C-terminal plays an important role in its ther-

mostability by the thermostable mutants Q307D, Y311K,

and I427L (Fei, et al., 2012). Subsequently, the team

also found that the salt bridge subtraction mutant E31Q

showed 13.96% thermostability decreasement, and the

salt bridge addition mutant Q307D showed 9.15% ther-

mostability enhancement than the wild-type both with-

out the pH and temperature optimum changed (Fei, et

al., 2013). Wu et al. found that Escherichia c oli phytase

mutants V89T, one from eleven mutants, exhibited

17.5% increase in catalytic activity (Wu, et al., 2014).

In this study, we sought methods that reformed the

phy tase AppA to enable it to withstand the high-tem-

perature feed pelleting process and retain a high level

of phytase activity at the low pH of the monogastric gut

environment (Yao, et al., 2013).

Using site-directed mutagenesis, we successfully

screened six mutants (M1, C2, K24E, K43E, M2, and

M4). Phy tase AppA was puri ed to homogeneity by

ammonium sulfate precipitation, anion exchange chro-

matography, and gel  ltration on a Superdex 75 col-

umn. Using the same strategy, we also obtained puri-

 ed protein from the six mutants. Subsequently, we

carried out experiments on optimal reaction pH and pH

stability, optimal reaction temperature, thermostability,

and the Michaelis constant. The six mutant enzymes

showed varying degrees of improvement in thermo-

stability compared with the wild-type enzyme, among

which the mutant K24E was the most stable even after

being heated to 80 °C or 90 °C for 20 min. As shown by

the results of the Michaelis constant, the K

of mutant

K24E was lower and the V

max

was higher than wild-type

AppA. Th e optimal reaction pH of K24E was 4.0 and

the residual activity of K24E remained above 90% after

tre atment in the pH range of 3.0–8.0 for 2 h. The optimal

reaction temperature of K24E was 60 °C, and the residual

activity of K24E remained above 60% after treatment in

70, 80, or 90 °C for 20 min. Using the Lineweaver–Burk

method, the K

and V

max

values of mutant K24E were

calculated to be 0.32 mM·L

−1

and 4.10 mmol·(m·mg)

−1

whereas K

and V

max

of AppA were 0.45 mM·L

−1

and 3.85

mmol·(m·mg )

−1

, respectively. The above results showed

the thermal resistance of mutant phytase AppA at 70-90

is higher than previously reported, (Liao, et al., 2013, Xu

et al., 2015 and Tan et al., 2016).

This result indicated that K24E has more af nity and

more catalytic ef ciency toward sodium phytate com-

pared with AppA. We applied a 3D structure analysis on

mutant K24E. SWISS-MODEL was employed for model

building of mutant K24E by using the X-ray structure of

phytase AppA as a template.

The validated mutant structure was aligned with the

wild-type structure by using SWISS-MODEL protein data

analysis. As shown in F ig. 4, the 3D conformations of

mutant K24E and AppA were found to have the same

structure, and a deep concave pocket harboring the

enzyme active site in the inner surface of the domains

was found. Mutant K24E was located at a supporting

point on the surface of the pocket edge structure and

close to the active center site. The replacement of Lys with

Glu, which has a smaller side chain, might reduce struc-

tural hindrances when combined with the substrate. This

phenomenon might be the reason behind the increased

af nity of enzyme and substrate and the decreased K

enzymatic reactions. The electrostatic interaction between

enzyme and substrate increased as the positively charged

Lys mutated into the negatively charged Glu. This inter-

FIGURE 4: Model of mutant K24E A: Model of mutant K24E; B: Model of AppA

Table 4: K

and V

max

of phytase AppA and its mutants

Sample AppA M1 C2 K24E K43E M2 M4

Km ( mM/L) 0.45 0.38 0.43 0.32 0.37 0.35 0.47

Vmax (mmol·m

−1

·mg

−1

) 3.85 2.86 2.16 4.10 4.04 3.18 2.04

The K

and V

max

value was averaged from three different experiments.

Jie Zhang et al.

364 MUTATION AND PHYTASE THERMAL STABILITY FROM

ESCHERICHIA COLI

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

action might be another reason for the increase of af nity

between phytase and its substrate. The isoelectric point of

Lys and Glu are pH 9.74 and 3.22, respectively. Substitu-

tion of Lys for Glu presumably contributes to the decrease

of the optimum reaction pH. Our results have showed that

phytase AppA mutant had excellent pH stability (Keeping

80% residual enzyme activity from pH 2.0 to 8.0 for 2 h

at 37° C), which is more favorable to apply to animal feed

than wild-type AppA and other phytase (Rocky-Salimi,

et al., 2016).

ACKNOWLEDGMENTS

This work was supported by grants from the Natural

Scienti c Foundation of Shandong Province, China

(ZR2014CM046, ZR2010CQ031 and ZR2015CL019) and

Collaborative Innovation Center of Chinese medicine

antivirus in Shandong University of Tranditional Chi-

nese Medicine (XTCX2014B01-07).

REFERENCES

Cereghino, J. L. and Cregg, J. M. (2000): Heterologous protein

expression in the methylotrophic yeast Pichia pastoris. FEMS

Microbiol Rev, 24, 45-66

Cregg, J. M., Cereghino, J. L., Shi, J. and Higgins, D. R. (2000):

Recombinant protein expression in Pichia pastoris. Mol Bio-

technol, 16, 23-52

Fan, C., Wang, Y., Zheng, C. and Fu, Y. (2013): Fingerprint

motifs of phytases. African Journal of Biotechnology, 12,

1138-1147

Fei, B., Cao, Y., Xu, H., Li, X., Song, T., Fei, Z. and Qiao, D.

(2013): AppA C-terminal plays an important role in its ther-

mostability in Escherichia coli. Curr Microbiol, 66, 374-378

Fei, B., Xu, H., Zhang, F., Li, X., Ma, S., Cao, Y., Xie, J., Qiao,

D. and Cao, Y. (2012): Relationship between Escherichia coli

AppA phytase’s thermostability and salt bridges. J Biosci Bio-

eng, 115, 623-627

Golovan, S., Wang, G., Zhang, J. and Forsberg, C. W. (2000):

Characterization and overproduction of the Escherichia coli

appA encoded bifunctional enzyme that exhibits both phytase

and acid phosphatase activities. Can J Microbiol, 46, 59-71

Greiner, R., Carlsson, N. and Alminger, M. L. (2001): Stere-

ospeci city of myo-inositol hexakisphosphate dephosphoryla-

tion by a phytate-degrading enzyme of Escherichia coli. J Bio-

technol, 84, 53-62

Greiner, R., Konietzny, U. and Jany, K. D. (1993): Puri cation

and characterization of two phytases from Escherichia coli.

Arch Biochem Biophys, 303, 107-113

Guerrero-Olazaran, M., Rodriguez-Blanco, L., Carreon-Trevino,

J. G., Gallegos-Lopez, J. A. and Viader-Salvado, J. M. (2010):

Expression of a Bacillus phytase C gene in Pichia pastoris and

properties of the recombinant enzyme. Appl Environ Micro-

biol, 76, 5601-5608

Haefner, S., Knietsch, A., Scholten, E., Braun, J., Lohscheidt, M.

and Zelder, O. (2005): Biotechnological production and appli-

cations of phytases. Appl Microbiol Biotechnol, 68, 588-597

Kim, M. S. and Lei, X. G. (2008): Enhancing thermostability

of Escherichia coli phytase AppA2 by error-prone PCR. Appl

Microbiol Biotechnol, 79, 69-75

Kim, M. S., Weaver, J. D. and Lei, X. G. (2008): Assembly of

mutations for improving thermostability of Escherichia coli

AppA2 phytase. Appl Microbiol Biotechnol, 79, 751-758

Kim, O. H., Kim, Y. O., Shim, J. H., Jung, Y. S., Jung, W. J.,

Choi, W. C., Lee, H., Lee, S. J., Kim, K. K., Auh, J. H., Kim,

H., Kim, J. W., Oh, T. K. and Oh, B. C. (2010): beta-propeller

phytase hydrolyzes insoluble Ca(2+)-phytate salts and com-

pletely abrogates the ability of phytate to chelate metal ions.

Biochemistry, 49, 10216-10227

Kim, Y. O., Kim, H. W., Lee, J. H., Kim, K. K. and Lee, S. J.

(2006): Molecular cloning of the phytase gene from Citrobacter

braakii and its expression in Saccharomyces cerevisiae. Bio-

technol Lett, 28, 33-38

Leytem, A. B., Widyaratne, G. P. and Thacker, P. A. (2008):

Phosphorus utilization and characterization of ileal digesta

and excreta from broiler chickens fed diets varying in cereal

grain, phosphorus level, and phytase addition. Poult Sci, 87,

2466-2476

Li, Z., Xiong, F., Lin, Q., d’Anjou, M., Daugulis, A. J., Yang, D.

S. and Hew, C. L. (2001): Low-temperature increases the yield

of biologically active herring antifreeze protein in Pichia pas-

toris. Protein Expr Purif, 21, 438-445

Liao, Y., Li, C. M., Chen, H., Wu, Q., Shan, Z. and Han, X. Y.

(2013): Site-directed mutagenesis improves the thermostabil-

ity and catalytic ef ciency of Aspergillus niger N25 phytase

mutated by I44E and T252R. Appl Biochem Biotechnol, 171,

900-915

Liao, Y., Zeng, M., Wu, Z. F., Chen, H., Wang, H. N., Wu, Q.,

Shan, Z. and Han, X. Y. (2012): Improving phytase enzyme

activity in a recombinant phyA mutant phytase from Aspergil-

lus niger N25 by error-prone PCR. Appl Biochem Biotechnol,

166, 549-562

Luo, H., Huang, H., Yang, P., Wang, Y., Yuan, T., Wu, N., Yao,

B. and Fan, Y. (2007): A novel phytase appA from Citrobacter

amalonaticus CGMCC 1696: gene cloning and overexpression

in Pichia pastoris. Curr Microbiol, 55, 185-192

Ming-Hui CHANG, C.-C. Y., Shiuan-Yuh CHIEN, A.B. ARUN

(2008): Expression of recombinant Pichia pastoris X33 phytase

for dephosphorylation of rice bran fermented liquid. Annals of

Microbiology, 58, 6

Noorbatcha, I. A., Sultan, A. M., Salleh, H. M. and Amid, A.

(2013): Understanding thermostability factors of Aspergillus

niger PhyA phytase: a molecular dynamics study. Protein J,

32, 309-316

Pal Roy, M., Mazumdar, D., Dutta, S., Saha, S. P. and Ghosh,

S. (2016): Cloning and Expression of Phytase appA Gene from

Shigella sp. CD2 in Pichia pastoris and Comparison of Proper-

ties with Recombinant Enzyme Expressed in E. coli. PLoS One,

11, e0145745

Jie Zhang et al.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS MUTATION AND PHYTASE THERMAL STABILITY FROM

ESCHERICHIA COLI

365

Pandee, P., Summpunn, P., Wiyakrutta, S., Isarangkul, D. and

Meevootisom, V. (2011): A Thermostable phytase from Neosar-

torya spinosa BCC 41923 and its expression in Pichia pastoris.

J Microbiol, 49, 257-264

Rocky-Salimi, K., Hashemi, M., Safari, M. and Mousivand, M.

(2016): A novel phytase characterized by thermostability and

high pH tolerance from rice phyllosphere isolated Bacillus sub-

tilis B.S.46. J Adv Res, 7, 381-390

Tan, H., Miao, R., Liu, T., Cao, X., Wu, X., Xie, L., Huang, Z.,

Peng, W. and Gan, B. (2016): Enhancing thermal resistance

of a novel Acidobacteria-derived phytase by engineering of

disul de bridges. J Microbiol Biotechnol,

Tran, T. T., Mamo, G., Buxo, L., Le, N. N., Gaber, Y., Matti-

asson, B. and Hatti-Kaul, R. (2011): Site-directed mutagenesis

of an alkaline phytase: in uencing speci city, activity and

stability in acidic milieu. Enzyme Microb Technol, 49, 177-

182

Wu, T. H., Chen, C. C., Cheng, Y. S., Ko, T. P., Lin, C. Y., Lai, H.

L., Huang, T. Y., Liu, J. R. and Guo, R. T. (2014): Improving spe-

ci c activity and thermostability of Escherichia coli phytase by

structure-based rational design. J Biotechnol, 175, 1-6

Xu, W., Shao, R., Wang, Z. and Yan, X. (2015): Improving the

neutral phytase activity from Bacillus amyloliquefaciens DSM

1061 by site-directed mutagenesis. Appl Biochem Biotechnol,

175, 3184-3194

Yao, M. Z., Wang, X., Wang, W., Fu, Y. J. and Liang, A. H.

(2013): Improving the thermostability of Escherichia coli

phytase, appA, by enhancement of glycosylation. Biotechnol

Lett, 35, 1669-1676

Yao, M. Z., Zhang, Y. H., Lu, W. L., Hu, M. Q., Wang, W. and

Liang, A. H. (2012): Phytases: crystal structures, protein engi-

neering and potential biotechnological applications. J Appl

Microbiol, 112, 1-14

Zhang, G. Q., Dong, X. F., Wang, Z. H., Zhang, Q., Wang, H.

X. and Tong, J. M. (2010): Puri cation, characterization, and

cloning of a novel phytase with low pH optimum and strong

proteolysis resistance from Aspergillus  cuum NTG-23. Biore-

sour Technol, 101, 4125-4131

Zhang, W., Mullaney, E. J. and Lei, X. G. (2007): Adopting

selected hydrogen bonding and ionic interactions from Asper-

gillus fumigatus phytase structure improves the thermostabil-

ity of Aspergillus niger PhyA phytase. Appl Environ Microbiol,

73, 3069-3076

Zhu, W., Qiao, D., Huang, M., Yang, G., Xu, H. and Cao, Y.

(2010): Modifying thermostability of appA from Escherichia

coli. Curr Microbiol, 61, 267-273