Genetic characterization of native

Bacillus thuringiensis

strains isolated from Tamil Nadu, India

D. Immanual Gilwax Prabhu

*, S. John Vennison

*, P. Thirumalai Vasan

and E. Kathiresan

Silkworm Breeding and Genetics, Central Tasar Research and Training Institute, Ranchi 835303, India

Department of Biotechnology, Anna University BIT-Campus, Tiruchirappalli 620024, India

Department of Biotechnology, Srimad Andavan College, Tiruchirappalli 620005, India

ABSTRACT

B. thuringiensis is a crystalliferous bacteria used as a biocontrol agent against lepidopteran, dipteran, and coleopteran

pests. Seventy eight Bacillus thuringiensis strains were isolated from 108 soil samples collected from Tamil Nadu, India.

Phylogenetic relationship of B. thuringiensis isolates were evaluated based on PCR ampli ed fragment polymorphisms

of  agellin genes (PCR-AFPF). The isolated B. thuringiensis strains comprised of 51.3% of known biochemical types and

48.7% of undescribed B. thuringiensis types. PCR-AFPF UPGMA dendrogram generated using Jaccard coef cient val-

ues showed two phylogenetic groups, group A and B comprised of I-XIII and XIV-XV clusters respectively. The present

study concluded that B. thuringiensis isolates from Tamil Nadu have a high degree of genetic diversity and high rate of

genetic exchange.

KEY WORDS:

BACILLUS THURINGIENSIS

, PCR-AFPF, GENETIC DIVERSITY, UPGMA DENDROGRAM

587

Biotechnological

Communication

Biosci. Biotech. Res. Comm. 11(4): 587-594 (2018)

INTRODUCTION

Chemical insecticides that are currently used to control

insect pests are extremely toxic to non-target organisms

and many insects have developed resistance to differ-

ent chemical pesticides, resulting in ineffective insect

control programs. They are deleterious to the health of

humans and animals, lead to cancer and immune system

disorders. In addition, chemical insecticides are recalci-

trant, it accumulates in the environment and result in

soil and water pollution (Devine and Furlong, 2007). The

use of microbial insecticides is an alternative to chemi-

cal pesticides for insect control. Biological insecticides

are mainly based on entomatopathogenic bacteria,

Bacillus thuringiensis.

ARTICLE INFORMATION:

Corresponding Authors: immanual.csb@gmail.com

Received 13

Sep, 2018

Accepted after revision 13

Dec, 2018

BBRC Print ISSN: 0974-6455

Online ISSN: 2321-4007 CODEN: USA BBRCBA

Thomson Reuters ISI ESC / Clarivate Analytics USA

Mono of Clarivate Analytics and Crossref Indexed

Journal Mono of CR

NAAS Journal Score 2018: 4.31 SJIF 2017: 4.196

Online Contents Available at:

http//www.bbrc.in/

DOI: 10.21786/bbrc/11.4/8

Immanual Gilwax Prabhu et al.

588 GENETIC CHARACTERIZATION OF NATIVE

BACILLUS THURINGIENSIS

STRAINS ISOLATED BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

B. thuringiensis is a member of a group of crystal-

liferous spore-forming gram-positive bacteria of the

family Bacillaceae (Schnepf et al., 1998). This bacte-

rium is able to produce proteinaceous parasporal crys-

tals that exhibit speci c insecticidal and nematicidal

activities (Khyami-Horani et al., 1996; Carneiro et al.,

1998; Al-Banna and Khyami-Horani, 2004). B. thur-

ingiensis is commonly used as an organic biopesticide

against lepidopteran, dipteran, and coleopteran insect

pests (Schnepf et al., 1998). B. thuringiensis was  rst

isolated from diseased silkworm (Bombyx mori) larvae

(Ishiwata, 1901). Over the last  ve decades, B. thuring-

iensis has been developed as a microbial agent against

lepidopteran pests (Carlton, 1990). In 1977, Goldberg

and Margalit (1977) discovered a novel B. thuringien-

sis strain that expressed speci c insecticidal properties

against Diptera and another B. thuringiensis strain that

targeted against Coleoptera was explored by Krieg et al.

(1983). The success of various B. thuringiensis strains in

controlling various insect pests has driven the establish-

ment of several screening programmes for more novel

B. thuringiensis strains. As a result, it is estimated that

today, more than 50,000 B. thuringiensis strains are kept

in various private and public bacterial collection centres

(Sanchis et al. 1996).

There are many methods have been proposed to clas-

sify B. thuringiensis into sub-species level. The main

classi cation of B. thuringiensis isolates was developed

on the basis of H- agellar antigens by de Barjac and

Bonnefoi (1962). B. thuringiensis strains are classi ed

into more than 82 serovars using H-antigen method.

However, there are two limitations with the H-classi-

 cation for strains lacking parasporal inclusions and

auto-agglutinated strains. Some B. cereus strains have

antigens that cross-react with sera speci c for B. thur-

ingiensis H-serotypes (14) and such isolates may origi-

nate from older B. thuringiensis strains that have lost

plasmid encoded crystals (Lecadet et al., 1999). These

auto-agglutinated strains make up almost 3% of the B.

thuringiensis in the International Entomopathogenic

Bacillus Center (IEBC) collection (Burges et al., 1982) at

the Institute of Pasteur, Paris, France, but the H-classi -

cation is completely useless on these strains. In addition,

a few B. thuringiensis strains, called non-motile strains

such as B. thuringiensis var. wuhanensis, also escape

H-serotyping (de Barjac and Frachon, 1990).

With the development of molecular biology, the clas-

si cation and identi cation of bacteria has changed

from traditional phenotypic to genotypic methods in

recent decades. Pulsed  eld gel electrophoresis (PFGE),

used for genotyping different bacterial strains of a spe-

ci c species as in the case of B. thuringiensis strains

(Gaviria and Priest, 2003). However, as PFGE requires

special equipment and chemicals, it is not easy to per-

form in many laboratories. Currently, molecular typing

methods including Arbitrary Primer PCR technology

(Brousseau et al., 1993), DNA reassociation measure-

ments (Nakamura, 1994), ribosomal RNA gene restric-

tion fragment length polymorphism (Priest et al., 1994;

Akhurst et al., 1997), ribosomal RNA gene intergenic

spacer sequences comparison (Bourque et al., 1995),

DNA-colony hybridization and random ampli ed pol-

ymorphic DNA (RAPD) analysis (Hansen et al., 1998),

have also been applied to a limited numbers of B. thur-

ingiensis strains. To date, molecular techniques such as

RAPD, RFLP, 16S rRNA probe, speci c DNA probe, and

ISR methods have not provided any great improvement

over the H-classi cation method. Hence, in the present

research, a faster, convenient and accurate method was

followed to classify all subspecies of B. thuringiensis

using PCR ampli ed fragment polymorphism of  agel-

lin genes (PCR-AFPF).

MATERIALS AND METHODS

Soil collection and isolation of B. thuringiensis: Soil

samples were collected from 108 locations in Tamil

Nadu, India, that are very diverse in nature. The sam-

ples were collected from agricultural  elds, high-altitude

mountains, forests, grasslands and sewage. Soil samples

were collected by scraping off surface material with a

sterile spatula and then obtaining a 10g sample from 1

or 2 cm below the surface. These samples were stored in

sterile plastic bags at ambient temperature. One gram of

soil was added to 10ml of Luria Broth, which was buff-

ered with 0.25M sodium acetate (Travers et al., 1987).

The mixture was shaken for 4h at 250 rpm in 30

C, after

incubation 1.5ml of sample mixture was taken and heat

shocked at 80

C for 3min. 100μl of the suspension was

plated on HiCrome™ Bacillus Agar supplemented with

10μg/ml of polymyxin B. Colonies formed after over-

night growth at 30ºC were selected based on colour

and colony morphology and the colony was transferred

onto TCHA medium supplemented with 0.3% glucose.

Cultures were allowed to grow and sporulate for 40h at

30ºC and the sporulated cultures were then checked for

the presence of crystals, which was the criterion used to

con rm the isolates as B. thuringiensis (Braun, 2000).

Biochemical identi cation

Fourteen biochemical tests such as acid production from

glucose, arabinose, xylose, mannitol, mannose, salicin

and sucrose; utilization of citrate and esculin; and pro-

duction of protease, amylase, phospholipase C or leci-

thinase, and hemolysin were performed as described by

Parry et al. (1983) to identify B. thuringiensis strains.

For this study, only the results of the following four (the

Immanual Gilwax Prabhu et al.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS GENETIC CHARACTERIZATION OF NATIVE

BACILLUS THURINGIENSIS

STRAINS ISOLATED 589

most relevant) biochemical tests are presented: esculin

utilization, acid formation from salicin and sucrose, and

lecithinase production (Martin and Travers, 1989). Based

on these four biochemical tests the B. thuringiensis iso-

lates classi ed into 16 biochemical types. The classi -

cation of B. thuringiensis strains in these groups was

corresponding to the distribution obtained by additional

tests.

PCR-AFPF

DNA C1000 thermal cycler (Bio-Rad) was used to carry

out PCR ampli cation. Cells of different B. thuringiensis

strains were inoculated on Luria-Bertani (LB) agar plates

and incubated at 30°C for 12 h. A loopful of cells was

suspended in 100 μl of nuclease free water in a 1.5-ml

Eppendorf tube. The cell suspension was frozen at -70

for 20 min and then boiled in water bath for 10 min.

The resultant lysate was centrifuged at 10,000 rpm for

10 min and  ve microliters of the supernatant was used

as a source of DNA template. The AFPF primers used in

this study was previously described by Yu et al. (2002)

and are listed (Table 1). Primer was obtained from Euro-

 ns MWG Operon, Germany. Each 50 μl of PCR mixture

contained 200 μM deoxynucleotide triphosphates, 2 μM

MgCl

, 12.5 pmol per primer, and 2 U of DreamTaq

DNA polymerase (Fermentas). Ampli cation was per-

formed using a single denaturation of 3 min at 94°C

followed by a 35 cycle program, with each cycle con-

sisting of denaturation at 94°C for 30 s, annealing at

45°C for 30 s, and extension at 72°C for 2 min; the  nal

extension step was 72°C for 10 min. The PCR ampli ed

products were detected by 1% agarose gel electrophore-

sis. The gels were scanned using AlphaImager gel docu-

mentation system.

Data analysis

Cluster analysis was used to examine genotypic rela-

tionships among the environmental B. thuringiensis

isolates and it was performed using the AlphaView soft-

ware, version 4.2 (Proteinsimple, CA). For data analy-

sis, the pro les were converted into binary matrix. The

computer cluster analysis was performed on the basis of

calculation of the Jaccard Coef cient using unweighted

pair group method with arithmetic mean (UPGMA)

(Kumar et al., 1993).

RESULTS AND DISCUSSION

Isolation of B. thuringiensis from soil: Totally 108 soil

samples were collected from different locations of 26

districts in Tamil Nadu, India. Soil samples were col-

lected from cultivated  elds (rice, sugarcane, coffee, tea,

mango, papaya, cabbage, onion, tomato, coconut, and

potato), natural vegetation (pine forests, shola forest,

reserved forest, tropical evergreen forest, and grasslands)

and sewage soils. The elevations of the places from

which the samples collected were highly variable, rang-

ing from sea level to 7,200 m above sea level. Among

82 soil samples, twenty six samples were collected from

hilly regions (Ooty, Yercaud, Kolli hills, Palani, Kodaika-

nal, Sirumalai).

After acetate and polymyxin B selection, 97 of 108

soil sample yield colonies. Of these 97 samples, 70

(72%) contained at least one crystal protein forming B.

thuringiensis strains. From the 70 soil samples, 78 B.

thuringiensis strains were isolated and separated from

173 other spore forming organisms. Overall, this sug-

gests that Tamil Nadu soils were enriched with B. thur-

ingiensis.With the advent of a very selective procedure

for separating B. thuringiensis spores from the spores

of other soil microbes, 78 B. thuringiensis strains have

been isolated through acetate and polymyxin B selec-

tion. The distribution of B. thuringiensis in Tamil Nadu,

is summarized (Table 2). In Tamil Nadu, the soil samples

collected from districts such as, Vellore, Thanjavur and

Theni were extremely rich in B. thuringiensis. Hundred

percent of the soil sample contained B. thuringiensis.

The soil sample collected from Krishnagiri, Nilgiris,

Coimbatore, Trichy, Tirunelvelli and Kanyakumari had

75 – 80% of B. thuringiensis strains. On the other hand,

soil samples collected from Ariyalur, Nagapatinam,

Madurai, Virudhunagar and Tuticorin, only 25 – 33% of

the soil samples contained B. thuringiensis strains.

Biochemical typing: The B. thuringiensis strains iso-

lated from Tamil Nadu were identi ed and classi ed

based on Martin and Travers (1989). In order to dis-

criminate the isolated B. thuringiensis strains in to 16

biochemical types, four biochemical tests such as escu-

lin utilization, acid formation from salicin and sucrose

and lecithinase production were carried out and these

were the most variable among B. thuringiensis isolates.

B. thuringiensis isolates were given the biochemical

type number based on the Martin and Travers (1989)

and their occurrence in Tamil Nadu is also recorded

(Table 3). Eventhough some of these types were differed

by a single biochemical tests, these difference were more

important. In this study B. thuringiensis subsp. kurstaki

is widely available in the environment differed from

leastly available B. thuringiensis subsp. galleriae by a

single biochemical test, lecithinase production. Among

Table 1. Nucleotide sequences of primers used for

PCR-AFPF and multiplex PCR

Primer

Name Sequence

Fla5 F – GGCGTCGACATGAGAATTAATACAAACATT

Fla3 R – CGCCTGCAGTTATTGTAATAATTTAGAAGCC

Immanual Gilwax Prabhu et al.

590 GENETIC CHARACTERIZATION OF NATIVE

BACILLUS THURINGIENSIS

STRAINS ISOLATED BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Table 2. Distribution of B. thuringiensis in soil

Districts

No. of samples

examined

% of samples with

thuringiensis

isolate (no.

of samples)

B. thuringiensis

indexa

(no. of

B. thuringiensis

isolates)

Chennai 4 50.0 (2) 0.22 (2)

Kanchipuram 4 50.0 (2) 0.33 (2)

Vellore 4 100.0 (4) 0.37 (3)

Krishnagiri 4 75.0 (3) 0.28 (4)

Villupuram 4 50.0 (2) 0.18 (2)

Nilgiris 4 75.0 (3) 0.40 (4)

Erode 4 50.0 (2) 0.22 (2)

Salem 4 75.0 (3) 0.38 (5)

Ariyalur 4 25.0 (1) 0.16 (1)

Perambulur 4 50.0 (2) 0.25 (2)

Namakkal 4 75.0 (3) 0.46 (6)

Coimbatore 4 75.0 (3) 0.36 (4)

Tiruppur 4 50.0 (2) 0.28 (2)

Karur 4 75.0 (3) 0.25 (2)

Trichy 4 75.0 (3) 0.27 (3)

Nagapattinam 4 33.3 (1) 0.16 (1)

Tiruvarur 4 66.6 (2) 0.40 (2)

Thanjavur 4 100.0 (4) 0.30 (4)

Pudukottai 4 75.0 (3) 0.33 (2)

Dindigul 4 100.0 (4) 0.30 (4)

Theni 4 100.0 (4) 0.33 (4)

Madurai 4 75.0 (2) 0.44 (4)

Virudhunagar 4 50.0 (2) 0.12 (1)

Tuticorin 4 50.0 (2) 0.28 (2)

Tirunelveli 4 75.0 (3) 0.36 (4)

Kanyakumari 4 75.0 (3) 0.60 (3)

Ramanathapuram 4 50.0(2) 0.28 (2)

Total 108 64.8 (70) 0.31 (78)

B. thuringiensis index was calculated as a number of B. thuringiensis strains isolated divided by the number of

colonies of all bacteria examined.

78 B. thuringiensis isolates, a maximum of 12 (15.4%) B.

thuringiensis subsp. kurstaki strains were isolated from

different soil samples. B. thuringiensis subsp. israelensis

was not present in any of the samples. The biochemical

types 9, 10, 11, 13, 15 and 16 made up a cluster of strains

which accounted for 48.7% of all environmental iso-

lates. The biochemical type of each isolates is recorded

(Table 3). The results are similar to the study reported

by Martin and Travers (1989), but they have got more

isolates of six undescribed B. thuringiensis biochemical

types (52%) than the known biochemical types (48%).

The widely accepted and well established typing

method for B. thuringiensis strains is serotyping. But the

current serotyping system is not suitable for auto agglu-

tinated strains, non-motile strains and strains lacking

a parasporal inclusion body. From the point of bacte-

rial systematic classi cation, serotyping is a phenotypic

system which cannot reveal phylogenetic relationships

among the strains (Joung and Côté, 2001).

Analysis of AFPF-PCR ampli ed products: PCR was

performed using cell lysate as DNA template with Fla5

and Fla3 primers. AFPF-PCR yielded multiple distinct

DNA products of sizes ranging from approximately 100

to 2000bp of more than 300 fragments from 78 B. thur-

ingiensis strains (Fig. 1). All B. thuringiensis isolates dif-

fered from one another in the speci c ampli ed patterns

of the PCR products, which correspond to the presence of

 agellin gene sequence. In these isolates the major num-

ber of bands was observed at the size of 100, 225 and

425bp. Most of the ampli ed products were observed

Immanual Gilwax Prabhu et al.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS GENETIC CHARACTERIZATION OF NATIVE

BACILLUS THURINGIENSIS

STRAINS ISOLATED 591

Table 3. Biochemical types of B. thuringiensis and its occurrence in Tamil Nadu, India

Biochemical Type

Biochemical test result

B. thuringiensis

isolates in Tamil

Nadu, India (%)Esculin Salicin Lecithinase Sucrose

1 (thuringiensis) + + + + 4 (5.1)

2 (kurstaki) + + + - 12 (15.4)

3 (indiana) + + - + 3 (3.8)

4 (galleriae) + + - - 1 (1.3)

5 (sotto) + - + + 3 (3.9)

6 (dendrolimus) + - + - 11 (14.1)

7 (morrisoni) + - - + 3 (3.8)

8 (darmstadiensis) + - - - 2 (2.6)

9 (Biochemical type 9) - + + + 4 (5.1)

10 (Biochemical type 10) - + + - 6 (7.7)

11 (Biochemical type 11) - + - + 1 (1.3)

12 (ostriniae) - + - - 1 (1.3)

13 (Biochemical type 13) - - + + 9 (11.5)

14 (israelensis) - - + - 0 (0)

15 (Biochemical type 15) - - - + 10 (12.8)

16 (Biochemical type 16) - - - - 8 (10.3)

Total 78

Martin and Travers, 1989

The + sign indicates a positive reaction; – sign indicates a negative reaction

FIGURE 1. PCR-AFPR  ngerprint patterns of environmental isolates of Bacillus thur-

ingiensis. (A) Bacillus thuringiensis Tamil Nadu (BTTN) isolates BTTN01 – BTTN20; (B)

BTTN20 – BTTN40; (C) BTTN41 – BTTN60; (D) BTTN61 – BTTN78. Lane M, 100bp ladder.

Immanual Gilwax Prabhu et al.

592 GENETIC CHARACTERIZATION OF NATIVE

BACILLUS THURINGIENSIS

STRAINS ISOLATED BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

FIGURE 2. UPGMA dendrogram derived from similarity

coef cients calculated by the Jaccard method based on

the ampli ed bands obtained during PCR-AFPF analy-

sis. The dendrogram shows the relationships among

environmental isolates of B. thunringiensis.

between 100 to 1000bp and only few of the isolates

(BTTN4, 6, 16, 23, 44, 56 and 66) contained fragments

more than 1000bp. Only a distinct single product with a

size of about 100 or 425bp was obtained in the strains

such as, BTTN19, 20, 21, 29, 38, 40, 60 and 70. The max-

imum of 12 to 14 bands ranged from sizes 100 – 2000bp

were observed in BTTN4, 23, 56 and 66.

PCR-AFPF is a preliminary attempt of Yu et al. (2002)

to classify the subspecies of B. thuringiensis obtained

from the Institute of Pasteur, France and in the present

study this tool is used to discriminate between the B.

thuringiensis serovars isolated from the environment.

The chromosome of all B. thuringiensis strains contain

 agellin gene and it was present even in their closely

related species B. cereus and B. anthracis. Its PCR ampli-

 cation pattern analysis is not subjected to any limi-

tation associated with the B. thuringiensis serotyping

system. The phyolgenetic analysis of B. thuringiensis

using PCR-AFPF would be more accurate, than previ-

ously described molecular classi cation methods such

as RAPD, RFLP, 16s rRNA probe, speci c DNA probe,

and ISR (Yu et al., 2002). The AFPF primers recognises

differences in the prevalence and positions of anneal-

ing sites in the genome producing sets of fragments that

are considered to re ect the genomic composition of the

strain, therefore it gives a good opportunity to detect

biodiversity of a group of isolates.

Phylogenetic analysis using UPGMA method: The

genetic distance, Jaccard coef cient values were calcu-

lated from ampli ed bands and the values were ranged

from 0.07 to 0.035 (Fig. 2). An unweighed pair group

method with average (UPGMA) dendrogram was con-

structed using the Jaccard coef cient. In UPGMA den-

drogram, the B. thuringiensis isolates were divided into

2 groups, group A and B. Group A was further classi-

 ed into 13 clusters (I - XIII), which comprised of 68 B.

thuringiensis isolates and remaining 10 strains, BTTN71,

33, 22, 39, 67, 32, 29, 18, 26 and 73 were categorized in

cluster XIV and XV and these two clusters were grouped

under group B. Among I to XV clusters, cluster I, X, XII

and XIV contains the mixture of different B. thuring-

iensis biochemical types and rest of the 11 clusters con-

tains any one of the biochemical types. The maximum

of 20.5% of B. thuringiensis isolates were classi ed

under cluster X and it comprised 6.25% of biochemi-

cal type 9, 25% of B. thuringiensis subsp. kurstaki and

68.75% of B. thuringiensis subsp. dendrolimus. At the

least of cluster XIII contained only one biochemical type

9 strain and this type showed more degree of variations

in their band pattern among their biochemical type and

these four biochemical type 9 strains were characterized

under 3 clusters (X, XI and XIII). This con rmation of

variation or intermixing of biochemical type 9 within

the clusters suggests that the speci c phenotypes were

acquired after the ancestors to each of the clusters were

formed. The study supports the idea that horizontal gene

transfer of plasmid is an important factor in de ning the

phenotypes of biochemical type 9 isolates evolved along

perceptible large evolutionary distances to give rise to

different clusters.

The study of Katara et al. (2012) demonstrated that

molecular typing and diversity analysis of B. thuringien-

sis has enormous importance for discrimination of strains

isolated from different sources. They distinguished 113

native B. thuringiensis strains isolated from various

Immanual Gilwax Prabhu et al.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS GENETIC CHARACTERIZATION OF NATIVE

BACILLUS THURINGIENSIS

STRAINS ISOLATED 593

locations in India using REP-PCR and ERIC-PCR. They

explored that the B. thuringiensis isolates collected from

diverse habitats in India had a high degree of genetic

diversity. Similar to them, the B. thuringiensis strains

which were isolated from Tamil Nadu showed diverse

range of patterns and high level of genetic diversity.

CONCLUSION

Through the present study, it is suggested that the asso-

ciation between B. thuringiensis and insects is not obli-

gative. B. thuringiensis was omnipresent when com-

pared to other bacterial strains and based on the nutrient

requirements the growth turnover is possible. There is

no need that the population of B. thuringiensis has to be

more in the soil samples with high levels of insect activ-

ity because several soil samples had been collected from

the mosquito breeding regions but no B. thuringiensis

isolates had shown any degree of mosquito larvicidal

activity. Finally, the genetic heterogeneity were analysed

in the B. thuringiensis strains isolated from Tamil Nadu

using AFPF-PCR. This technique could be used for the

separation of novel B. thuringiensis isolates from the

environment.

REFERENCES

Akhurst, R.J., Lyness, E.W., Zhang, Q.Y., Cooper, D.J., Pinnock,

D.E. (1997) A 16S rRNA oligonucleotide probe for identi ca-

tion of Bacillus thuringiensis isolates from sheep  eece. J.

Invertebr. Pathol. 69, 24–31.

Al-Banna, L., Khyami-Horani, H. (2004) Nematicidal activity

of two Jordanian strains of Bacillus thuringiensis on root-knot

nematodes. Nematol. Mediterr. 32, 41–45.

Bourque, S.N., Valero, J.R., Lavoie, M.C., LeÂvesque, R.C. (1995)

Comparative analysis of the 16S to 23S ribosomal intergenic

spacer sequences of Bacillus thuringiensis strains and subspe-

cies and of closely related species. Appl. Environ. Microbiol.

61, 1623-1626.

Braun, S. (2000) Production of Bacillus thuringiensis insec-

ticides for experimental uses. In: Navon, A., Ascher, K.R.S.

(Eds.), Bioassays of Entomopathogenic Microbes and Nema-

todes, CABI, London, UK, pp. 49-72.

Brousseau, R., Saint-Onge, A., PreÂfontaine, G., Masson, L.

And Cabana, J. (1993) Arbitrary primer polymerase chain reac-

tion, a powerful method to identify Bacillus thuringiensis sero-

vars and strains. Appl. Environ. Microbiol. 59, 114-119.

Burges, H.D., Aizawai, A., Dulmage, H.T., de Barjac, H. (1982)

Numbering of the H-serotypes of Bacillus thuringiensis. J.

Invertebr. Pathol. 40, 419.

Carlton, B. (1990) Alternatives for suppressing agricultural

pests and diseases. In: Baker, R.R., Dunn, P.E., Liss, A.R. (Eds.),

New Directions in Biological Control. New York: American

Elsevier Publishing Co., pp. 419-434.

Carneiro, R.M.D.G., de Souza, I.S., Belarmino, L.C. (1998)

Nematicidal activity of Bacillus spp. strains on juveniles of

Meloidogyne javanica. Nematol. Brasileira. 22, 12–21.

de Barjac, H., Bonnefoi, A. (1962) Essai de classi cation bio-

chimique et serologique de 24 souches de Bacillus du type B.

thuringiensis. Entomophaga 7, 5–31

de Barjac, H., Frachon, E. (1990) Classi cation of Bacillus

thuringiensis strains. Entomophaga 35, 233–240

Devine, G.J., Furlong, M.J. (2007) Insecticide use: contexts and

ecological consequences. Agric. Human Values 24, 281–306.

Gaviria, R.A.M., Priest, F.G. (2003) Pulsed  eld gel electropho-

resis of chromosomal DNA reveals a clonal population struc-

ture to Bacillus thuringiensis that relates in general to crystal

protein gene content. FEMS Microbiol. Lett. 223, 61– 66.

Goldberg, L.Y., Margalit, J. (1977) A bacterial spore demon-

strating rapid larvicidal activity against Anopheles sergentii,

Uranotaenia unguiculata, Culex univittatus, Aedes aegypti and

Culex pipiens. Mosq. News 37, 355-358.

Hansen, B., Damgaard, P.H., Eilenberg, J., Pedersen, J.C. (1998)

Molecular and phenotypic characterization of Bacillus thur-

ingiensis isolated from leaves and insects. J. Invertebr. Pathol.

71, 106-114.

Ishiwata, S. (1901) On a kind of severe  acherue (sotto disease).

Dainihan Sanshi Kaiho 114, 1-5.

Joung, K.B., Côté, J.C. (2001) Phylogenetic analysis of Bacil-

lus thuringiensis serovars based on 16S rRNA gene restriction

fragment length polymorphisms. J. Appl. Microbiol. 90, 115-22.

Katara, J., Deshmukh, R., Singh, N.K., Kaur, S. (2012) Molecular

typing of native Bacillus thuringiensis isolates from diverse

habitats in India using REP-PCR and ERIC-PCR analysis. J.

Gen. Appl. Microbiol. 58, 83-94.

Khyami-Horani, H., Katbeh-Bader, A., Mohsen, Z.H. (1996)

Mosquito larvicidal toxicity of endospore-forming bacilli iso-

lated in Jordan. Dirasat. Med. Biol. Sci. 23,140–144

Krieg, A., Huger, A.M., Langenbruch, G.A., Schnetter, W. (1983)

Bacillus thuringiensis

var. tenebrionis, a new pathotype effec-

tive against larvae of Coleoptera. Zeitschrift für Angewandte

Entomologie 96, 500 - 508.

Kumar, S., Tamura, K., Nei, M. (1993) MEGA: Molecular Evolu-

tionary Genetics Analysis, version 1.0 (user manual), The Penn-

sylvania State University, University Park, PA 16802, USA.

Lecadet, M.M., Frachon, E., Dumanoir, V.C., Ripouteau, H.,

Hamon, S., Laurent, P., Thiery, I. (1999) Updating the H-anti-

gen classi cation of Bacillus thuringiensis. J. Appl. Microbiol.

86, 660–672.

Martin, P.A.W., Travers, R.S. (1989) Worldwide Abundance and

Distribution of Bacillus thuringiensis Isolates. Appl. Environ.

Microbiol., 55, 2437-2442.

Nakamura, L.K. (1994) DNA relatedness among Bacillus thur-

ingiensis serovars. Int. J. Syst. Bacteriol. 44, 125-129.

Parry, J.M., Turnball, P.C.B., Gibson, J.R. (1983) A Colour Atlas

of Bacillus Species. Wolfe Medical Publications, Ltd., London.

United Kingdom.

Immanual Gilwax Prabhu et al.

594 GENETIC CHARACTERIZATION OF NATIVE

BACILLUS THURINGIENSIS

STRAINS ISOLATED BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Priest, F.G., Kaji, D.A., Rosato, Y.B., Canhos, V.P. (1994) Char-

acterization of Bacillus thuringiensis and related bacteria by

ribosomal RNA gene restriction fragment length polymor-

phisms. Microbiology 140, 1015-1022.

Sanchis, V., Chaufaux, J., Lereclus, D. (1996) Amélioration

biotechnologique de Bacillus thuringiensis: les enjeux et les

risques. Annales de l’Institut Pasteur/Actualités 7, 271-284.

Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J.,

Feitelson, J., Zeigler, D.R., Dean, D.H. (1998) Bacillus thuring-

iensis and its pesticidal crystal proteins. Microbiol. Mol. Biol.

Rev. 62, 775–806.

Travers, R.S., Martin, P.A.W., Reichelderfer, C.F. (1987) Selec-

tive process for ef cient isolation of soil Bacillus sp. Appl.

Environ. Microbiol. 53, 1263-1266.

Yu, J., Tan, L., Liu, Y., Pang, Y. (2002) Phylogenetic analy-

sis of Bacillus thuringiensis based on PCR ampli ed fragment

polymorphisms of  agellin genes. Curr. Microbiol. 45, 139-

43.