Biotechnological

Communication

Biosci. Biotech. Res. Comm. 11(2): 238-245 (2018)

Effects of probiotic in expression of RUNX-2, ALP,

OCN and CASP-3 genes in Wistar albino rat receiving

2Gy gamma radiation

Omid Azadbakht

, Vahid Changizi

*, Elahe Motevaseli

, Sedighe Kolivand

and

Pegah Khanzadeh

Technology of Radiology and Radiotherapy Department, Allied Medical Sciences School, Tehran University of

Medical Sciences, Tehran, Iran

Molecular Medicine Department, Advanced Technologies in Medicine School, Tehran University of Medical

Sciences, Tehran, Iran

Medical Biotechnology Department, Advanced Technologies in Medicine School, Tehran University of

Medical Sciences School, Tehran, Iran

ABSTRACT

Today, radiotherapy is responsible for most of the therapies in a variety of cancers. However it could causes harm effects

like bone de ciency. Bone reinforces human body. On the other side probiotics are living microorganisms that have been

used in many studies to reduce the incidence of certain cancers or treat them. Therefore we decided to study if it is possible

to use probiotics against bone lost. Male albino Wistar rats for four weeks were put under a diet of two types of probi-

otic Lactobacillus casei and Lactobacillus acidophilus. After the diet, the groups were subjected to radiation with a cobalt

60 apparatus. Then the bone marrow immediately was extracted and examined the expression of the osteogenic genes

(RUNX-2, OCN, ALP) and CASPASE-3 (which is effective in apoptosis) by the Real Time PCR machine for the  rst time .In

this study, we found that osteogenesis was much higher in groups with the probiotic diet than those without the probiotic

diet. Lactobacillus acidophilus was also found to be more effective than Lactobacillus casei. Also, the use of these probiot-

ics increases the expression of the CASPASE-3 gene in the common pathway of apoptosis, which means that probiotics

increase apoptosis. This study showed probiotics could repair the harmful effects of ionizing radiation on bones.

KEY WORDS: BONE MARROW, RADIATION, PROBIOTICS,

LACTOBACILLUS ACIDOPHILUS, LACTOBACILLUS CASEI

238

ARTICLE INFORMATION:

*Corresponding Author: changizi@sina.tums.ac.ir

Received 17

March, 2018

Accepted after revision 27

June, 2018

BBRC Print ISSN: 0974-6455

Online ISSN: 2321-4007 CODEN: USA BBRCBA

Thomson Reuters ISI ESC / Clarivate Analytics USA and

Crossref Indexed Journal

NAAS Journal Score 2018: 4.31 SJIF 2017: 4.196

Online Contents Available at: http//www.bbrc.in/

DOI: 10.21786/bbrc/11.1/7

Omid Azadbakht et al.

INTRODUCTION

All living things, including humans, are constantly

exposed to natural and human sources of ionizing radia-

tion. Effective dose of the background is about 2.4 mSv

per year. The major man-made origin of human expo-

sure is radio diagnosis and Radiation therapy for cancer

patients, (Wang, et al., 2016). Radiotherapy uses high-

energy rays to kill cancer cells. This may be done alone

or in mixture with other treatments such as surgery or

chemotherapy, (Spyropoulos, et al., 2011). Radiation

therapy is an important part of the treatment regimen in

various human malignancies, and for many non-treat-

able pain management. It is estimated that 50-70% of

all oncology patients are treated with radiation therapy,

or a combination of chemotherapy and radiation ther-

apy programs, (Michelin et al., 2004). To eliminate most

of the malignant tumors, ionizing radiation requires

approximate dose regimens near tolerance to adjacent

tissues. On the other hand tissues that contain renewal

cells, such as bone marrow and gastric mucosal mucosa,

require fast cell proliferation and there are more sus-

ceptible to toxic effects of ionizing, (Michelin, et al.,

2004). Bone damage in due to radiotherapy has been

con rmed in epidemiological and animal studies. Bone

is one of the most common natural tissues, and would

have harmful effects a like fractures and loss of bone

marrow function after radiotherapy, (Mego et al., 2013)

osteogenesis associated genes are, RUNX-2, ALP, OCN

and adipogenesis associated genes are PPAR- and C/

EBP, (Mansouri-Tehrani et al., 2015).

It should be noted that apoptosis is a cell death

mechanism with various physical and biological causes.

It plays a major role in many natural and physiologi-

cal processes, as well as in the pathogenesis of various

diseases, (Liu et al., 2013). Apoptosis can be activated

through the extrinsic and mitochondrial dependent

pathway. All paths eventually lead to caspase activation.

(Jilka, et al., 1998) on the other hands probiotics are liv-

ing microorganisms that help to preserve the bene cial

microbial balance in humans or other hosts as drugs or

dietary supplements. Most probiotics belong to a group

of lactic acid producing bacteria (Lactobacilli, Strep-

tococci, and Bi dobacterium). Some of the inhumane

strains are used in the fermentation of dairy products,

while others are human intestinal biochemistry, (Weiss

et al., 2011). Lactobacilli and Bi dobacterium are

generally known as probiotics due to their bene cial

effects on health and include various effects, such as

deprivation and inhibition of pathogens in the intes-

tine, increased integration of intestinal epithelium and

modulation of the host immune system both locally

and systemically, (Dobrzy

ska et al., 2015). So, based

on the above, we decided to use probiotics as a diet to

reduce the effects of radiation on the bone marrow and

reduce apoptosis.

MATERIAL AND METHODS

36 male Wistar rats with weighting of 220 ± 220 g were

purchased from the Tehran University of Medical Sciences

Pharmaceutical Research Center in 6 groups at the animal

house for four weeks prior to exposure to radiation. The

groups were kept in special cages under constant ambient

conditions at 22 ± 2 ° C and the light was adjusted for 12

hours of light and 12 hours of darkness. Water and spe-

cial food were provided to animals without restrictions,

except during tests. All experiments were conducted on

the basis of ethical standards for animal behavior.

THERE WERE SIX RATS IN EACH GROUP:

1. Non-radiation and non-probiotic group (control

group)

2. Non-radiation group with Lactobacillus casei pro-

biotics

3. Without radiation and with probiotic consumption

of Lactobacillus acidophilus

4. Group with irradiation and no probiotic consump-

tion

5. Radiation and probiotic Lactobacillus casei group

6. Radiation and probiotic group Lactobacillus aci-

dophilus

GAVAGE

0.1 g of each bacterium is equivalent to 10

CFU / g, the

amount of each serving was set for each group. Then for

each rat, the calculated amount of each drug was dis-

solved in one ml of PBS buffer (pH 7.2) and Daily, once

for Lactobacillus acidophilus and three times for Lacto-

bacillus casei, the calculated data was fed to a stomach

rat with a gavage needle. Also, control groups received

1 ml of PBS buffer per day.

IRRADIATION

The mice were anesthetized with ethical standards. At the

center of radiotherapy at Imam Khomeini Hospital in Teh-

ran, 60 cobalt irradiation devices were exposed to 2Gy and

a dose rate of 100 cGy /min in a  eld with a size of 34.8

cm in 34.8 cm and an SSD of 80 cm were placed. Mice

were sacri ced by displacement of the neck. The animal

skeletal was washed in 70% ethanol. We discrete the mus-

cle and cut the two ends of the thigh bone. 10 ml syringe

by a 27-degree needle was injected from one end of the

thigh bone and was poured from the other end of thigh

bone into the test tube. Using centrifuge at 1000 rpm for

seven minutes, the solvent phase was discarded. These test

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS EFFECTS OF PROBIOTIC IN EXPRESSION OF RUNX-2, ALP, OCN AND CASP-3 GENES 239

Omid Azadbakht et al.

tubes were placed in a freezer at a temperature of minus

80 (-80) degrees.

TOTAL RNA EXTRACTION

We extract a 5mm

piece of bone marrow tissue and

added 1 ml of RNA extraction solution and then homog-

enized the mixture with the homogenizer. 200 l of cold

chloroform was added to the solution and the tubes were

shaken vigorously for 15 seconds. Then the tubes were

incubated for 5 minutes in ice. The tubes were centri-

fuged for 15 min at 4 ° C and 12,000 rpm. After centrifu-

gation, three layers were formed in each vial from up

to down including the aqueous phase RNA, the protein

phase in the middle with white color, and the green phe-

nolic phase at the bottom. The upper phase was slowly

detached and transferred to a new 1.5-ml sterile tube.

Equilibrium solution was added to cold isopropanol and

incubated after mixing for 10 min at -20° C, then centri-

fuged for 15 min at 4 ° C and 12,000 rpm. To remove any

impurities, the super uous solution was discarded. The

RNA precipitate was rinsed gently with a milliteratanol;

after adding ethanol 80%, the tubes were slowly gutted

several times and then centrifuged for 10 min at 4 ˚C

and 12,000 rpm. The supernatant was removed slowly

and the sediment was placed for 10-15min at the labora-

tory temperature to dry. RNA deposition added to twenty

microliters of treated water with DEPC. The solution was

placed on a hot plate at 50-55 ° C for 5 minutes to solve

the RNA, then the tubes were kept in - 80 ° C freezer.

EVALUATE RNA QUALITY

To evaluate RNA quality, electrophoresis gel was used.

Before electrophoresis, all devices were treated with

DEPC water. Electrophoresis was performed in 1% aga-

rose gel. The gels were stained with ethidium bromide.

DETERMINE THE CONCENTRATION OF

EXTRACTED RNA

To determine the concentration of RNA, the BioTek

Nano Drop device was used. The OD= 260/280 expresses

the purity of the extracted RNA and has an inverse rela-

tionship with RNA contamination with the protein. The

aforementioned ratio close to 2 represents the absence of

contamination with the protein.

The ratio 260/230 was also used to check out the amount

of RNA contaminated with the materials used for extrac-

tion. It is desirable that this number is also close to 2.

SYNTHESIS OF CDNA

The master mix was made and added to each tube

(all the work was done on ice). One microgram of the

extracted RNA was used to synthesize cDNA. As a result,

the amount of the required RNA was calculated based on

its concentration in the sample and added to the tube.

The tubes were transmitted to the thermocycler, and the

cDNA synthesis reaction was performed according to the

following procedure.

Finally, the cDNA was maintained at -20 ° C.

PRIMER

Primers used in these experiments were designed and

tested using NCBI and Gene Runner software. By the

company Sinoclon with OD about 2 was made as freeze-

dried. The table 3 shows the characteristics of the prim-

ers used in this thesis.

REAL-TIME PCR STEPS

All ingredients were removed from the freezer and let

to melt gently. Master Mix was kept in aluminum foil to

protect it against light. According to the table 4, a mix-

ture of the desired materials was prepared to do real time

PCR with  nal volume of 20 microliter. All reactions

were repeated twice. Special microcircuits were put in

a cold box with pins and the ingredients were added to

each of them according to the instructions below. All the

microtubules completely were sterilized to avoid error

in results. To control the contamination of the reaction

during the test, one sample without cDNA was consid-

ered for each gene, as a template called the NTC.

INGREDIENTS FOR REAL TIME PCR

The results of Real Time PCR were obtained from the

Corbett-6000 device.

Data analysis:

the results of the Real Time were analyzed through a

Fafel test. After analysis, one-way analysis of variance

Table 1. Materials for synthesis of cDNA

ingredientsQuantity

RT Buffer (x5)µl2

primer(50µM) oligo dTµl0.5

Primer:Random Hexamer(100µM)µl5/0

Reverse TranscriptaseEnzyme µl0.5

Sterilized water treated with DEPC

The  nal volume is

10 L

Table 2. Thermosilocera device program for reverse

transcription reaction

timeTemperature (°c)The type of reaction

15 min37

Synthesis of single-

stranded cDNA

5 s85Enzyme inactivation

240 EFFECTS OF PROBIOTIC IN EXPRESSION OF RUNX-2, ALP, OCN AND CASP-3 GENES BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Omid Azadbakht et al.

Table 3. Characteristics of primers

ODlengthTmSequencesprimer

22259.2F:CAGACCTAGCAGACACCATGAG

OCN

22258.5R:GGACATGAAGGCTTTGTCAGAC

22059F:CGTTTTCACGTTTGGTGGCT

ALP

22058.9R:ACCGTCCACCACCTTGTAAC

22058.1F:GGCCACTTACCACAGAGCTA

RUNX-2

22058.3R:AGGCGGTCAGAGAACAAACT

22059.35F:AGCTGGACTGCGGTATTGAG

CASPASE-3

22057.3R:ATGGCGCAAAGTGACTGGAT

Table 4. Materials for Real Time PCR

MaterialsVolumeFinal concentration

Master Mix 2Xµl10X1

cDNAµl2ng/reaction100

M10forward primerl 8/0M4/0

M 10 reverse primer l 8/0M4/0

water RNase- Freeµl4/6-

(ANOVA) was performed. Because there was a meaning-

ful difference between the different groups, we set up

the Tukey HSD Post-hoc test and compared the different

groups.

RESULTS AND DISCUSSION

Data analysis results for RUNX-2 gene between different

research groups are shown in  gure 1. It can be seen that

all the groups had a higher expression than the control

group ( rst group), while only the second group had no

signi cant difference compared to the control group.

In groups three, four,  ve and six, there is a signi -

cant increase compared to the second group. The fourth

group is also the only group that has a signi cant differ-

ence compared to the third group, the difference is also

signi cant. The last signi cant difference was observed

in this chart is for groups  ve and four, which expresses

the decline of group  ve compared to group four. Data

FIGURE 1. The RUNX-2 gene expression chart in different groups is the

vertical axis of the gene expression and the horizontal axis of the tested

groups. R means radiation, D1 is probiotic Lactobacillus casei and D2 probi-

otic Lactobacillus acidophilus.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS EFFECTS OF PROBIOTIC IN EXPRESSION OF RUNX-2, ALP, OCN AND CASP-3 GENES 241

Omid Azadbakht et al.

FIGURE 2. The OCN gene expression chart in different groups is the vertical

axis of the gene expression and the horizontal axis of the tested groups. R

means radiation, D1 is probiotic Lactobacillus casei and D2 probiotic Lacto-

bacillus acidophilus.

FIGURE 3. The ALP gene expression chart in different groups is the vertical

axis of the gene expression and the horizontal axis of the tested groups. R

means radiation, D1 is probiotic Lactobacillus casei and D2 probiotic Lactoba-

cillus acidophilus.

analysis results for OCN gene between different research

groups are revealed in  gure 2 .

Figure 2 shows a signi cant increase in the expres-

sion of the three, four,  ve, and six groups relative to

group one. And all groups except group 1 have a signi -

cant increase compared to the second group.

Figure 3 shows data analysis for ALP gene between

different research groups.

The four,  ve, and six groups showed a signi cant

increase compared to the control group in Figure 3. It

can also be seen that groups four and  ve have a sig-

ni cant increase compared to the second group. The last

result indicated in this chart is the increase in ALP gene

expression in groups four,  ve and six compared to the

third group.

Figure 4 reveals data analysis for CASPASE-3 gene

between different research groups. Increasing the expres-

sion of groups 3, 4 , 5 and 6 was signi cantly different

from that of the control group. Fourth and sixth groups

also had a signi cant increase compared to the second

group. The fourth group is the only group that has sig-

ni cantly increased relative to the third group. The  fth

and sixth groups also had a signi cant decrease com-

pared to the fourth group, which is visible on the chart.

In order to better understand the conclusions and con-

clusions about the results of the study, the mechanisms

of the effect of probiotics should be considered  rst. The

mechanism of action of these probiotics includes the pro-

duction of inhibitor compounds, competition for binding

sites, competition for food, elimination of tox Enhances

242 EFFECTS OF PROBIOTIC IN EXPRESSION OF RUNX-2, ALP, OCN AND CASP-3 GENES BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Omid Azadbakht et al.

the immune system by increasing the level of cytokines,

immunoglobulins activating macrophages and mononu-

cleosis, and increasing the activity of natural killer cells,

self-immune modulation and the production of TNF

and interleukin 6.in receptors and ultimately boosting the

immune system. The tumor necrosis factor effect has three

pathways: one way reaches to caspase-3, and the second

can be terminated into three different functions, namely

pre-apoptosis, proliferation and cellular differentiation,

and the third pathway is the anti-in ammatory route .

Caspase-3:

All groups under the probiotic diet were more likely to

increase than the control group because of the mecha-

nism of probiotic effects on TNF alpha, which increases

the expression of CASPASE-3. Groups under the Lacto-

bacillus acidophilus probiotic diet, in the presence, and

in the absence of radiation, gave rise to the expres-

sion of the CASPASE-3 gene in comparison to the only

radiation group, since probiotics express the expres-

sion of CASPASE-3 in accordance with the above men-

tioned mechanism. Lactobacillus acidophilus group

has increased expression in lactose-bacillus casei in

the presence and absence of radiation, which probably

indicates a greater effect of Lactobacillus acidophilus

than Lactobacillus casei. The Lactobacillus acidophilus

group has a greater expression than the Lactobacil-

lus acidophilus group with radiation, which indicates

radiation and Lactobacillus acidophilus neutralize each

other. Perhaps radiation in the bone marrow may pro-

duce an immunological status that is more favorable

than the pathway of differentiation and proliferation

cells arrive.

RUNX-2:

All groups under the probiotic diet were more likely to

be exposed than the control group and the radiation

group, as probiotics increase the cellular differentiation

and multiply their pathways. The Lactobacillus acido-

philus group has been shown to have a higher expres-

sion than Lactobacillus casei (both in the presence and

in the absence of radiation), indicating a greater effect

of Lactobacillus acidophilus.

ALP:

Groups that have taken Lactobacillus acidophilus (both in

the presence of radiation and in the absence of radiation)

have a greater expression than the control group, which

is probably due to the effect of Lactobacillus acidophilus.

Lactobacillus casei group has a signi cant increase in

expression in comparison with the control group, prob-

ably due to the synergistic effect of the radiation and pro-

biotics. Because according to the radiation signal path and

the osteoblastic signal path, radiation can ultimately cause

cellular sensitivity so that the cell shows the counter-

effects of radiation. This issue of the effects of signals can

be investigated in the future. Groups that have taken Lac-

tobacillus acidophilus (both in the presence of radiation

and in the absence of it) have a higher expression than

the Lactobacillus casei group; it indicates the greater effect

of Lactobacillus acidophilus. The Lactobacillus casei group

(in the presence of radiation) has a greater expression than

Lactobacillus casei which is due to synergistic effect.

OCN:

All groups under the probiotic diet have increased

expression in both the control group and the radiation

FIGURE 4. The CASPASE-3 gene expression chart in different groups is the

vertical axis of the gene expression and the horizontal axis of the tested

groups. R means radiation, D1 is probiotic Lactobacillus casei and D2 probiotic

Lactobacillus acidophilus.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS EFFECTS OF PROBIOTIC IN EXPRESSION OF RUNX-2, ALP, OCN AND CASP-3 GENES 243

Omid Azadbakht et al.

group because probiotic activates the second alpha-TNF

pathway, resulting in differentiation and proliferation.

CONCLUSION

This study shows, the use of probiotics increase the

expression of osteogenic genes and apoptosis, except in

cases where this increase was not signi cantly expressed.

According to the results and analysis, probiotic Lactoba-

cillus acidophilus has a greater effect on Lactobacillus

casei. That is, this probiotic increased the expression of

the two groups of radiation and control. Although it also

expands the gene for apoptosis. In general, the use of

probiotics in this study increased the expression of oste-

ogenic genes and apoptosis, except in cases where this

increase was not signi cantly expressed. In some stud-

ies, we observed that radiation combined with two pro-

biotics has different effects of synergistic and inhibitory

effects for two probiotics, which is probably due to the

effect of various probiotics in their signal paths, which

is not exactly clear and can be tracked and researched.

ACKNOWLEDGMENTS

This study has been supported by Tehran University of

Medical Sciences.

Con ict of interest: There is no con ict of interest.

Funding: This study was funded by Tehran University of

Medical Sciences (grant number: 33517).

Ethical approval: All applicable international, national,

and/or institutional guidelines for the care and use of

animals were followed.

REFERENCES

Alwood, J. S., Shahnazari, M., Chicana, B., Schreurs, A.,

Kumar, A., Bartolini, A., Globus, R. K. (2015). Ionizing radia-

tion stimulates expression of pro-osteoclastogenic genes in

marrow and skeletal tissue. Journal of Interferon & Cytokine

Research, 35(6), 480-487.

Britton, R. A., Irwin, R., Quach, D., Schaefer, L., Zhang, J., Lee,

T., McCabe, L. R. (2014). Probiotic L. reuteri treatment prevents

bone loss in a menopausal ovariectomized mouse model. Jour-

nal of cellular physiology, 229(11), 1822-1830.

Cai, S., Kandasamy, M., Rahmat, J. N., Tham, S. M., Bay, B. H.,

Lee, Y. K., & Mahendran, R. (2016). Lactobacillus rhamnosus GG

activation of dendritic cells and neutrophils depends on the dose

and time of exposure. Journal of immunology research, 2016.

Chen, M., Ona, V. O., Li, M., Ferrante, R. J., Fink, K. B., Zhu, S.,

Hersch, S. M. (2000). Minocycline inhibits caspase-1 and cas-

pase-3 expression and delays mortality in a transgenic mouse

model of Huntington disease. Nature medicine, 6(7), 797.

Ciorba, M. A., & Stenson, W. F. (2009). Probiotic Therapy in

RadiationInduced Intestinal Injury and Repair. Annals of the

New York Academy of Sciences, 1165(1), 190-194.

Ciorba, M. A., Riehl, T. E., Rao, M. S., Moon, C., Ee, X., Nava,

G. M., Stenson, W. F. (2012). Lactobacillus probiotic protects

intestinal epithelium from radiation injury in a TLR-2/cyclo-

oxygenase-2-dependent manner. Gut, 61(6), 829-838.

Collins, F. L., Irwin, R., Bierhalter, H., Schepper, J., Britton,

R. A., Parameswaran, N., & McCabe, L. R. (2016). Lactobacil-

lus reuteri 6475 increases bone density in intact females only

under an in ammatory setting. PLoS One, 11(4), e0153180.

Dasika, G. K., Lin, S.-C. J., Zhao, S., Sung, P., Tomkinson, A.,

& Lee, E. Y. P. (1999). DNA damage-induced cell cycle check-

points and DNA strand break repair in development and tumo-

rigenesis. oncogene, 18(55), 7883.

Demers, M., Dagnault, A., & Desjardins, J. (2014). A rand-

omized double-blind controlled trial: impact of probiotics

on diarrhea in patients treated with pelvic radiation. Clinical

Nutrition, 33(5), 761-767.

Deng, H., Li, Z., Tan, Y., Guo, Z., Liu, Y., Wang, Y., Bai, Y. (2016).

A novel strain of Bacteroides fragilis enhances phagocytosis and

polarises M1 macrophages. Scienti c reports, 6, 29401.

Dobrzy

ska, M. M., Gajowik, A., & Radzikowska, J. (2015). The

effect of in vivo resveratrol supplementation in irradiated mice

on the induction of micronuclei in peripheral blood and bone

marrow reticulocytes. Mutagenesis, 31(4), 393-399.

Fernandes, K. R., Ribeiro, D. A., Rodrigues, N. C., Tim, C.,

Santos, A. A., Parizotto, N. A., Renno, A. C. (2013). Effects of

low-level laser therapy on the expression of osteogenic genes

related in the initial stages of bone defects in rats. Journal of

biomedical optics, 18(3), 038002.

Gamian, A. (2014). Distinct immunomodulation of bone mar-

row-derived dendritic cell responses to Lactobacillus plan-

tarum WCFS1 by two different polysaccharides isolated from

Lactobacillus rhamnosus LOCK 0900. Applied and environ-

mental microbiology, 80(20), 6506-6516.

Gaur, U., & Aggarwal, B. B. (2003). Regulation of proliferation,

survival and apoptosis by members of the TNF superfamily.

Biochemical pharmacology, 66(8), 1403-1408.

Gerbitz, A., Schultz, M., Wilke, A., Linde, H.-J., Schölmerich, J.,

Andreesen, R., & Holler, E. (2004). Probiotic effects on experi-

mental graft-versus-host disease: let them eat yogurt. Blood,

103(11), 4365-4367.

Giralt, J., Regadera, J. P., Verges, R., Romero, J., de la Fuente,

I., Biete, A., Guarner, F. (2008). Effects of probiotic Lactobacil-

lus casei DN-114 001 in prevention of radiation-induced diar-

rhea: results from multicenter, randomized, placebo-controlled

nutritional trial. International Journal of Radiation Oncology

Biology Physics, 71(4), 1213-1219.

González Pereyra, M., Dogi, C., Torres Lisa, A., Wittouck, P.,

Ortíz, M., Escobar, F., Torres, A. (2014). Genotoxicity and

cytotoxicity evaluation of probiotic Saccharomyces cerevisiae

RC016: a 60day subchronic oral toxicity study in rats. Journal

of applied microbiology, 117(3), 824-833.

244 EFFECTS OF PROBIOTIC IN EXPRESSION OF RUNX-2, ALP, OCN AND CASP-3 GENES BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Omid Azadbakht et al.

Górska, S., Schwarzer, M., Jachymek, W., Srutkova, D., Brzozo-

wska, E., Kozakova, H., &

Hall, E., & Giaccia, A. (2006). Radiobiology for the Radiologist

Lippincott Williams & Wilkins: Philadelphia.

Hayashi, M., Morita, T., Kodama, Y., Sofuni, T., & Ishidate

Jr, M. (1990). The micronucleus assay with mouse peripheral

blood reticulocytes using acridine orange-coated slides. Muta-

tion Research Letters, 245(4), 245-249.

Huang, B., Guang, M., Ye, J., Gong, P., & Tang, H. (2015). Effect

of increasing doses of -radiation on bone marrow stromal

cells grown on smooth and rough titanium surfaces. Stem cells

international, 2015.

Ji, J., Hu, S.-L., Cui, Z.-W., & Li, W.-F. (2013). Probiotic Bacil-

lus amyloliquefaciens mediate M1 macrophage polarization in

mouse bone marrow-derived macrophages. Archives of micro-

biology, 195(5), 349-356.

Jilka, R. L., Weinstein, R. S., Bellido, T., Par tt, A. M., & Manol-

agas, S. C. (1998). Osteoblast programmed cell death (apopto-

sis): modulation by growth factors and cytokines. Journal of

Bone and Mineral Research, 13(5), 793-802.

Khoshtabiat, L., & Mahdavi, M. (2015). The Role of Oxidative

Stress in Proliferation and Cell Death. Journal of Mazandaran

University of Medical Sciences, 25(127), 130-145.

Li, J., Yan, M., Wang, Z., Jing, S., Li, Y., Liu, G., Fan, Z. (2014).

Effects of canonical NF-B signaling pathway on the pro-

liferation and odonto/osteogenic differentiation of human

stem cells from apical papilla. BioMed research international,

2014.

Liu, C., Zhang, C., Mitchel, R. E., Cui, J., Lin, J., Yang, Y., Cai,

J. (2013). A critical role of toll-like receptor 4 (TLR4) and its’

in vivo ligands in basal radio-resistance. Cell death & disease,

4(5), e649.

Mansouri-Tehrani, H.-A., Rabbani-Khorasgani, M., Hosseini,

S. M., Mokarian, F., Mahdavi, H., & Roayaei, M. (2015). Effect

of supplements: Probiotics and probiotic plus honey on blood

cell counts and serum IgA in patients receiving pelvic radio-

therapy. Journal of research in medical sciences: the of cial

journal of Isfahan University of Medical Sciences, 20(7), 679.

Mariman, R., Kremer, B., Koning, F., & Nagelkerken, L. (2014).

The probiotic mixture VSL# 3 mediates both pro-and anti-

in ammatory responses in bone marrow-derived dendritic

cells from C57BL/6 and BALB/c mice. British Journal of Nutri-

tion, 112(7), 1088-1097.

Mego, M., Holec, V., Drgona, L., Hainova, K., Ciernikova, S.,

& Zajac, V. (2013). Probiotic bacteria in cancer patients under-

going chemotherapy and radiation therapy. Complementary

therapies in medicine, 21(6), 712-723.

Meltz, M. L., Reiter, R. J., Herman, T. S., & Kumar, S. (1999).

Melatonin and protection from whole-body irradiation: sur-

vival studies in mice. Mutation Research/Fundamental and

Molecular Mechanisms of Mutagenesis, 425(1), 21-27.

Michelin, S., del Rosario Perez, M., Dubner, D., & Gisone, P.

(2004). Increased activity and involvement of caspase-3 in

radiation-induced apoptosis in neural cells precursors from

developing rat brain. Neurotoxicology, 25(3), 387-398.

Mozdarani, H., & J Vessal, N. (1993). Cimetidine Can Modify

The Effects Of Whole Body ‘y Irradiation On Lymphohemat-

opoietic System. Medical Journal of The Islamic Republic of

Iran (MJIRI), 7(2), 95-99.

Norizadeh Tazehkand, M., Topaktas, M., & Yilmaz, M. B. (2016).

Assessment of chromosomal aberration in the bone marrow

cells of Swiss Albino mice treated by 4-methylimidazole. Drug

and chemical toxicology, 39(3), 307-311.

Porter, A. G., & Jänicke, R. U. (1999). Emerging roles of cas-

pase-3 in apoptosis. Cell death and differentiation, 6(2), 99.

Rodríguez, M. L., Martín, M. M., Padellano, L. C., Palomo, A.

M., & Puebla, Y. I. (2010). Gastrointestinal toxicity associated

to radiation therapy. Clinical and Translational Oncology,

12(8), 554-561.

Salva, S., Marranzino, G., Villena, J., Agüero, G., & Alvarez, S.

(2014). Probiotic Lactobacillus strains protect against myelo-

suppression and immunosuppression in cyclophosphamide-

treated mice. International immunopharmacology, 22(1), 209-

221.

Seal, M., Naito, Y., Barreto, R., Lorenzetti, A., Safran, P., &

Marotta, F. (2007). Experimental radiotherapyinduced enteri-

tis: A probiotic interventional study. Journal of digestive dis-

eases, 8(3), 143-147.

Spyropoulos, B. G., Misiakos, E. P., Fotiadis, C., & Stoidis, C. N.

(2011). Antioxidant properties of probiotics and their protec-

tive effects in the pathogenesis of radiation-induced enteritis

and colitis. Digestive diseases and sciences, 56(2), 285-294.

Spyropoulos, B. G., Theodoropoulos, G., Misiakos, E. P., Stoidis,

C. N., Zapatis, H., Diamantopoulou, K., Machairas, A. (2013).

The effect of synbiotics on acute radiation-induced diarrhea

and its association with mucosal in ammatory and adaptive

responses in rats. Digestive diseases and sciences, 58(9), 2487-

2498.

Steeve, K. T., Marc, P., Sandrine, T., Dominique, H., & Yannick,

F. (2004). IL-6, RANKL, TNF-alpha/IL-1: interrelations in bone

resorption pathophysiology. Cytokine & growth factor reviews,

15(1), 49-60.

Vejdani, R. , Zali, M. R. (2003). Probiotics and the mechanism

of their effect on the prevention and treatment of Human dis-

eases. Shahid Beheshti University of Medical Sciences.Tehran.

Iran, 27(4) 319-330.

Wang, Y., Zhu, G., Wang, J., & Chen, J. (2016). Irradiation alters

the differentiation potential of bone marrow mesenchymal

stem cells. Molecular medicine reports, 13(1), 213-223

Weiss, G. , Christensen, H. R. , Zeuthen, L.H. , Vogensen, F.K. ,

& Jakobsen, M. (2011). Lactobacilli and bi dobacteria induce

differential interferon-b pro les in dendritic cells. Cytokine,

56(2), 520–530.

Yavropoulou, M. P., & Yovos, J. G. (2007). The role of the Wnt

signaling pathway in osteoblast commitment and differentia-

tion. Hormones-Athens-, 6(4), 279.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS EFFECTS OF PROBIOTIC IN EXPRESSION OF RUNX-2, ALP, OCN AND CASP-3 GENES 245