Biomedical

Communication

Biosci. Biotech. Res. Comm. 10(2): 32-39 (2017)

Detection of

Plasmodium

Anopheles arabiensis

using

nested-PCR in Jazan region, Saudi Arabia

O.M. Dafalla

, A.A. Alsheikh

, Abakar AD

, WS Mohammed

, Samira H Abd Elrahman

and EM Noureldin

National Center for Vector-Borne Diseases, MoH-Jazan, Saudi Arabia

Department of Medical Parasitology, Faculty of Medical Laboratory Sciences, University of Gezira, Sudan

Blue Nile National Institute for Communicable Diseases, Wad Medani, Sudan

ABSTRACT

The present study was carried out in 26 villages at two Governates (Al-Khobah, and Haroob) in Jazan Region in

Southwest Saudi Arabia to identify and detect the presence of Plasmodium in Anopheles arabiensis using nested-PCR

technique. An. Arabiensis was identi ed by PCR and it was the predominant Anopheles mosquito in all the collec-

tion sites. A total of 257 An. Arabiensis females were collected and two samples from two villages (Almuatan and

Alsabkha) out of 107 (1.87%) female mosquitoes from Haroob Governate were found positive for the sporozoites of

Plasmodium falciparum. Similarly, 3 out of 150 (2%) female mosquito samples from Um-alkhameir, AL-Khobah Gov-

ernate, were also found positive. Around fourfold increase of thesporozoite rate (from 0.61 to 2.0%) in An. arabiens

is in AL-Khobah Governate has been observed compared to the previous study of 2007-2008. The wide spread of

An. arabiensis in Jazan region with >90% of the malaria cases caused by P. falciparum, along with infectivity rate

ranges between 1.87 to 2.0% for P. falciparum in Al-Khobah and Haroob Governates, suggests that P. falciparum

is the most predominant malaria parasite and An. Arabiensis is a very ef cient malaria vector in the region. It also

suggestsmore in-depth researches on the ecology, behavior, and control of An. Arabiensis to promote area-speci c

control programs.

KEY WORDS: MALARIA, JAZAN, SAUDI ARABIA,

PLASMODIUM FALCIPARUM

, PCR,

ANOPHELESARABIENSIS

ARTICLE INFORMATION:

*Corresponding Author: omerosa@yahoo.com

Received 14

May, 2017

Accepted after revision 27

June, 2017

BBRC Print ISSN: 0974-6455

Online ISSN: 2321-4007 CODEN: USA BBRCBA

Thomson Reuters ISI ESC and Crossref Indexed Journal

NAAS Journal Score 2017: 4.31 Cosmos IF : 4.006

reserved.

Online Contents Available at: http//www.bbrc.in/

Dafalla et al.

INTRODUCTION

Malaria is an infectious disease caused by the bites of

femaleAnophelesmosquitoes infected with Plasmodium

spp. (Cowman &Crabb, 2006).There are approximately

 fteen Anopheles species present in Saudi Arabia, but

only four play a major role in parasitic transmission;

these species are Anopheles arabiensis, Anopheles ser-

gentii, Anopheles stephensi, and Anopheles Superpic-

tus (Sebai, 1988; Zahar, 1985). Anopheles arabiensis

has been identi ed as the primary vector transmitting

malaria in Tihama area (southwest of Saudi Arabia and

northeast Yemen)(Alsheikh, 2004),andconsidered to be

a very ef cient transmitting vector in the Afro-tropical

area, with large variations in life behaviour including

feeding, resting, and breeding(Beiernand Koros, 1991;

Coetzee and Le Sueur, 1988).Five species of Plasmo-

diumhave long been recognized to infecthumans; these

species include Plasmodium falciparum (the most viru-

lent form of malaria with approximately 90% malaria

deaths globally),Plasmodium vivax (the most common

cause of malaria globally), Plasmodiummalariae, Plas-

modiumovale and Plasmodiumknowlesi (WHO,2016).

The annual estimates of WHO in December 2015 for

malaria were 214 million cases of and 438 000 deaths,

with 3.2 billion people were at risk of malaria trans-

mission (WHO, 2016). The disease remains a consider-

able threat due to several reasons, such as transmission

enabling environments, poverty, lack of awareness,

impaired health system infrastructures, political and

socioeconomic problems, mass population migration

and the emergence of multi-drug resistance (WHO, 2011;

WHO, 2014).

In Saudi Arabia, about 5% of the Saudi population

is at risk of malaria (approximately 2.4million people)

(Alsheikh, 2011). The disease is restricted to the South

Western region of Tihama (Jazan and Asir), where more

than 70% of all malaria cases in the country are occurred

(El Hassan et al, 2015). Moreover, from 2000 to 2014

there were 5522 known locally acquired cases of malaria

and around 9936 imported cases (El Hassan et al, 2015).

Identifying the presence of sporozoites of human

malaria in the salivary glands of potential Anophe-

line vectors is the  nal step in establishing vector

status(Alsheikh, 2004).Moreover, the determination of

sporozoite rates has been considered as the most impor-

tant entomological factor in the epidemiology of human

malaria (Wirtz et al, 1987).

The intensity of malaria transmission is determined

by calculating the entomological inoculation rate (EIR),

as a simple estimated parameter, which is the product of

the man-biting rate (de ned as the number of bites per

person per night) and the sporozoite rate (Reisen and

Boreham, 1982; Dye, 1986). Although vectorial capacity

is also a useful estimator of potential transmission inten-

sity (Garret- Jones and Shidrawi, 1969), it is often dif -

cult to determine with reliability owing to the numerous

biological parameters required for its estimation.There

are three techniques have been used for identi cation of

Plasmodium sporozoites in salivary glands of Anopheles

female mosquitoes. These include; ordinary microscopy

dissection, immunological techniques, and polymer-

ase chain reaction (PCR) (Burkot et al, 1984; Beier

et al, 1988; Alsheikh, 2004).The latter has the poten-

tial for detecting and screening malaria parasites, espe-

cially in endemic regions, as well as in monitoring the

effectiveness of malaria therapy (Moody, 2002; Morassin

et al, 2002; Gama et al, 2007).Al-Maktari and Bassiouny

(1999)in Yemen have recorded sporozoitesrate of 0.7%

(4/600) for P. falciparumin An. arabiensis using micro-

scopy method.

In Jazan region, Saudi Arabia, Al-Sheikh (2011)

reported 0.61% as sporozoite rate of P. falciparumin A.

arabiensis collected in 2007 – 2008 using nested PCR.

To the best of our knowledge, since that date no other

data in Jazan region or other areas of Saudi Arabia has

been published on the determination of sporozoite rate

of P. falciparum in A. arabiensis using nested-PCR. The

present study thushas been conducted to detect and

identify the infectious Plasmodium species inside the

malarial vector Anopheles arabiensis using nested-PCR

techniques comparing previous data.

MATERIAL AND METHODS

This study was carried out at two small Governates (Al-

Khobah, and Haroob) in the Jazan Region in Southwest

Saudi Arabia, lies between 16°-12, and 18°-25, latitude

north (Alsheikh, 2011), with a total area of about 22,000

km2 and 1.3 million populations (census 2011). Thirty

percent of the population concentrated in six major

cities, and the remainders living in over 3500 villages

(Fig. 1) (Alsheikh, 2011).

Jazan region is situated in the subtropical zone and

has average monthly temperatures ranging between

25.8°C in January to 33.4°C in July. The average relative

humidity ranges from 55% and 72.5%. The rainy sea-

son is started at August through October with a monthly

average of 77 and 56.7 mm, respectively (Alsheikh,

2011).

Anopheles arabiensis specimens were collected from

indoor human dwellings of 26 villages distributed in

tow Governates (Al-Khobah and Haroob) from January

to December 2015 (Table 1). The two Governates were

selected based on the presence of An. Arabiensis and

the reports of malaria cases.The collection of specimens

was performed using Pyrethrum Knockdown (PKD)

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS DETECTION OF

PLASMODIUM

ANOPHELES ARABIENSIS

Dafalla et al.

FIGURE 1. The map of Jazan region showing its different Governates.

Table 1. Number and distribution of Anopheles arabiensis collected from 26 villages of

Alkhobah and Haroob (January – December 2015)

Serial

No.

Al-khobah Governate

Serial

No.

Haroob Governate

Villages No. of samples Villages No. of samples

1 Wabrah 5 1 GaeimMahroog 13

2 GaeimMzubaid 15 2 Haroob city 4

3 ZahrAljamal 5 3 Al-muatan 12

4 Um-alturab 17 4 Al-gahmah 9

5 Al-mujarad 19 5 Al-sabkhah 21

6 Al-mushbah 6 6 Al-maseer 9

7 Al-mudeirah 6 7 Al-zamlah 11

8 Al-mafrag 5 8 Al-dahmah 11

9 Al-abteiah 11 9 Al-zahab 9

10 Um-alkhameir 22 10 Al-kudmy 8

11 Al-garn 5

12 Al-girwaneiah 6

13 Um-alhegil 7

14 Al-rahmaneiah 7

15 Al-jarshab 8

16 Shargan 6

Total 150 Total 107

collections as described by WHO (1992). Collected mos-

quitoes were brought to the National Center for Vector-

Borne Diseases in Jazan for morphological and molecu-

lar identi cation, and sporozoite rate determination.

The collected mosquitoes were identi ed based on

morphological features given by Glick (1992) and Mat-

tingly (1956). A total of 257 An. Arabiensis females were

preserved individually in 1.5 ml plastic tube, labeled,

34 DETECTION OF

PLASMODIUM

ANOPHELES ARABIENSIS

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

Dafalla et al.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS DETECTION OF

PLASMODIUM

ANOPHELES ARABIENSIS

capped, and stored at -86 until further investigation.

After removing the legs, wings, and abdomen, the mos-

quito samples were homogenized individually in a mor-

tar and pestle (mini borosilicate glass chamber length

60mm / pestle diameter 9.0mm 3.0Ml, Fisherbrand) in

100 L of Minimum Essential Media (MEM) (manufac-

tured Euro Clone, UK). The homogenate was saved in

-86 degree till next procedure.

4- DNA EXTRACTION

DNA was extracted from the stored homogenate using

RealLine DNA – Extraction 2 (BIORON Diagnostic, Ger-

many) following the manufacture´s recommendations:

300 L of lysis Reagent with sorbent (magnetic parti-

cles) added to homogenate in 1.5 tubes and placed into

the thermo shaker for  ve minutes at 65°C, 1300 rpm.

Then 400 L of DNA precipitation solution was added to

each tube and mixed for 15 seconds in a vortex. Samples

were then centrifuged at 13000 rpm for  ve minutes at

room temperature then the supernatant discarded and

the pellet was washed twice and driedfor 2-3 minutes

at room temperature. Specimen solution used to re-sus-

pend the DNA. The extracted DNA stored at -86°C till

next procedure

The morphological identi cation of Anopheles ara-

biensis has been con rmed by PCR using the procedure

described by Scott et al (1993), and the primer used and

PCR conditions are shown in Table 2. Nested PCR pro-

cedures were carried out for detection and identi cation

of Plasmodium species as described by Snounou et al.

(1993a). DNA samples were ampli ed by oligonucle-

otide primers obtained from Integrated DNA Technol-

ogy (Belgium), targeting the Plasmodium small subunit

ribosomal RNA (ssRNA) genes (Waters and McCutchan,

1989) (Table 2). Primer pair’s rPLU5 and rPLU6 used to

detect Plasmodium genus in Primary ampli cation and

species-speci c primers rFAL1/rFAL2 (P. falciparum)

and rVIV1/rVIV2 (P. vivax) for nested PCR in 2 sepa-

rated reactions.

In brief, primary and nested PCR were carried out

in total 25 µl reaction volume, each containing 12.5 µl

GoTag®G2 green master mix ready to use from Promega

and25µM of each primer. Five µl of extracted DNA was

used as a sample for the primary ampli cation and 2

µl of the PCR product for the nested PCR. In each run,

negative and positive controls were included. Thermal

cycling was done in T100 thermal cycler (Bio-Rad, USA).

PCR primers and conditions are shown in Table 2. The

PCR products of nested ampli cation were analyzed by

gel electrophoresis (1.5 agarose in Tris-Acetate EDTA

buffer) staining with ethidium promide. The visualiza-

tion was carried out using Gel Doc XR Imaging System

(Bio-Rad).

Table 2. Primers used in the detection of sporozoite of Plasmodium and the identi cation of An. arabiensis, and

PCR conditions

Species Primer Name Sequence (5-3)

PCR Product

Size (BP)

PCR Condition

Plasmodium sp.

rPLU5

rPLU6

CCTGTTGTTGCCTTAAACTTC

TTAAAATTGTTGCAGTTAAAACG

110 0

Initial denaturation at 94°C for 3

min, 35 cycles of denaturation at

94°C for 60 seconds, annealing

at 60°C for 90 seconds,

extension at 72°C for 90 seconds

and  nal extension for 5 minutes

P. falciparum

rFAL1

rFAL2

TTAAACTGGTTTGGGAAAACC

AAATATATT

ACACAATGAACTCAATCATGA

CTACCCGTC

205

Initial denaturation at 94°C for 3

min, 35 cycles of denaturation at

94°C for 60 seconds, annealing

at 55°C for 90 seconds,

extension at 72°C for 90 seconds

and  nal extension for 5 minutes

P. vivax

rVIV1

rVIV2

CGCTTCTAGCTTAATCCACAT

AACTGATAC

ACTTCCAAGCCGAAGCAAAGA

AAGTCCTTA

120

Initial denaturation at 94°C for 3

min, 35 cycles of denaturation at

94°C for 60 seconds, annealing

at 55°C for 90 seconds,

extension at 72°C for 90 seconds

and  nal extension for 5 minutes

An. arabiensis

Universal primer

Species speci c

GTG TGC CCC TTC CTC GAT GT

AAG TGT CCT TCT CCA TCC TA

315

Initial denaturation at 94°C for 3

min, 35 cycles of denaturation at

94°C for 60 seconds, annealing

at 50°C for 60 seconds,

extension at 72°C for 60 seconds

and  nal extension for 5 minutes

Dafalla et al.

36 DETECTION OF

PLASMODIUM

ANOPHELES ARABIENSIS

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

RESULTS

A total of 315bp segments of the IGS region of rRNA

gene sequences of An. Arabiensis were ampli ed (Figure

2). An. arabiensis was found as the predominant Anoph-

eles mosquitoes in all the collection sites. All samples

which were previously identi ed morphologically as

An. arabiensis had beenalso molecularly con rmedby

PCR(Fig 2).

Our molecular surveillance covered a total of 26 vil-

lages distributed in tow Governates (16 in Al-Khobah

and 10 in Horoob) and lasted from January to Decem-

ber 2015. Two samples from two villages (Almuatan and

Alsabkha) out of one hundred and seven (1.87%) female

mosquitoes collected from HaroobGovernate were found

positive for the sporozoites of Plasmodium falciparum

(Table 3).

Similarly, three out of one hundred  fty (2%) female

mosquito samples collected from 16 villages of AL-

KhobahGovernate were also found positive. These three

positive samples were from Um Alkhameir village. All

the positive nested PCR samples that detect P. falci-

parum show band in (205bp) (Fig 3).

DISCUSSION

Anopheles arabiensis is the potential primary vector

of malaria in Jazan region. Alsheikh (2004)has identi-

 ed An. arabiensis in the Tihama region (Saudi Ara-

bia and Yemen) using species-speci c diagnostic PCR,

and showed that it is the only member of An. gambiae

complex found in the Tihamaregion.In this study, the

only detected Plasmodium species inthe femaleof An.

Arabiensis mosquitoes using nested-PCR method isPlas-

modium falciparum, aresult which coincides with the

 ndings of Alsheikh (2004)who reported that P. falci-

parum represents more than 95% of malaria cases in the

Tihama area (including Jazan region).The determination

of sporozoites infection in wild Anopheles mosquitoes

FIGURE 2. Identi cation of An. Arabiensis by PCR.

Table 3. Detection of Plasmodium sporozoites from An. arabiensis by PCR method

Governate

No of villages

surveyed

Total samples

collected

Positive samples Species detected

Horoob 10 107 2 (1.87%) P. falciparum

AlKhobah 16 150 3 (2%) P. falciparum

Total 26 257 5 (2.3) P. falciparum

Dafalla et al.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS DETECTION OF

PLASMODIUM

ANOPHELES ARABIENSIS

considers an integral part in vector incrimination and

malaria transmission dynamics in affected areas and

epidemiological research (Alsheikh, 2004).

In this study, Thesporozoite rate of 1.87 %and 2%

inHaroob and AlkhobahGovernates, respectively,

(Table 3) reinforces the need to intensify the control

efforts to compact the vector and reduce malaria trans-

mission. We noticed a fourfold increase in thesporozoite

rate of P. falciparumin An. arabiensis in Alkhobah Gov-

ernate in the present study from 0.61 to 2% compared

to the previous study in 2007-2008 (Alsheikh, 2011).

This could be attributed to the current war on the bor-

der of Yemen, where Alkhobah is located, which hin-

ders the control measures against An. arabiensis usu-

ally used to be conducted in the area before the start of

the war.

Harada et al. (2000) have also observed fourfold

increase in thesporozoite rate (0.62 to 2.2%) in Anoph-

elesgambiaes. s. in Ghana using the PCR method. In

Solomon’s Islands, P. falciparum was detected in 15.2%

of Anophelesfarauti by PCR technique (Wilson et al,

1998).Few previous studies in the Tihamaregion had

determined the sporozoite rate of Plasmodium species

in Anopheles mosquitoes. For instance inSaudi Arabia,

Plasmodium sporozoites had been detected in 0.65% of

An. arabiensis using nested- PCR(Alsheikh, 2004), and

in 0.9 % of 2921 An. arabiensis (23 P. falciparum, and

2 P. vivax) using ELISA method, while P. falciparum-

sporozoites were detected in An. sergentii (2/295) and

a single female of An. algeriensisin Yemen (Al-Eryani

et al., 2016).

In East African countries such as Sudan, the P. fal-

ciparum sporozoite rate in An. arabiensis was found to

be 4.5% in Sennar State using ELISA technique(Elmahdi

et al., 2012), and 1.4-15% in eastern part of the country

(Hamad et al., 2002). While in Ethiopia, it was 0.3% forP.

falciparumand 0.5% for P. vivax (Tirados et al., 2006),

and in Eritrea, it ranges from 0.54 to 1.3% (Shililu et al.,

2004). In Asia, the sporozoite rate of P. falciparum was

higher (10%) in An. stephensi from District Shiekhupura

in Pakistan (Oneeb et al., 2015). Whereas, in various

parts of India, sporozoite rates range from 0.012 to 0.2%

in Anophelesannularis were reported using microscopic

method, but the malaria parasite species could not be

identi ed (Dash et al., 1982; Gunasekaran et al., 1989;

Ghosh et al., 1985).However, Mahapatra et al. (2006) in

Keonjhar district, Orissa, India, have detected 3.4% spo-

rozoite rate in Anophelesannularis using PCR technique,

and have identi ed the malaria parasite species to be P.

falciparum.

Infectivity rate of 10.6% P. falciparum in Anopheles

gambiae complex was found by Snounou et al.(1993b)in

Guinea Bissau using PCR method. Four out of  ve (80%

sporozoite rate) wild caught Anophelesdirus were found

positive for the sporozoites of P. falciparum using PCR

method, although they were negative when using ELISA

technique (Tassanakajon et al., 1993), which re ected

the high sensitivity of the PCR method.Variations in

sporozoite rates in An. arabiensis from a country to

another or within the same country could be attributed

to the seasonal variations in transmission(Alsheikh,

2004).The wide spread of Anopheles arabiensis in Jazan

FIGURE 3. Detection of Plasmodium species by PCR method in An. Arabiensis.

Dafalla et al.

38 DETECTION OF

PLASMODIUM

ANOPHELES ARABIENSIS

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS

region with >90% of the malaria cases caused by P.

falciparum, along with infectivity rate ranges between

1.87 to 2.0%for P. falciparum, suggests more in-depth

researches on its ecology, behavior, and control to pro-

mote area-speci c control programs.

CONCLUSION

The current study indicated the signi cance of using

PCR technology in detecting the presence of Plasmo-

dium species in Anopheles mosquitoes. Our  ndings

revealed an infectivity rate of Anopheles arabiensis

ranges between 1.87 to 2.0% for P. falciparum in two

Governates Haroob and Al-Khobah of the Jazan region,

respectively.The wide spread of An. arabiensis in Jazan

region with >90% of the malaria cases caused by P. fal-

ciparum, along with infectivity rate ranges between 1.87

to 2.0% for P. falciparum in Al-Khobah and Haroob-

Governates, suggests that P. falciparum is the most pre-

dominant malaria parasite and A. Arabiensis is a very

ef cient malaria vector in the region.Further detection

for the sporozoite of Plasmodium species in Anopheles

mosquitoes need to be conducted in the rest ofJazan

region to determine their infectivity rates by malaria

parasites. The importance of detailed knowledge of dis-

ease vectors along with their sporozoite rates is of vital

importance in the promotion of area-speci c control

interventions and programs.

CONFLICT OF INTEREST

The authors declared no con ict of interest.

REFERENCES

Al-Eryani SM, Kelly-Hope L, Harbach RE, Briscoe AG, Barnish

G, Azazy A 2016: Entomological aspects and the role of human

behaviour in malaria transmission in a highland region of the

Republic of Yemen. Malar J. 15:1.

Al-Maktari, M., and Bassiouny, H. 1999: Bionomics of Ano-

pholine vectors in Zabid District, Al-Hodeidah, Governorate,

Republic of Yemen, Eastern Mediterranean Health Journal.

5(4): 698-705.

Alsheikh, A.A. 2004:Studies on the ecology, vectorial role in

malaria transmission and population structure of Anopheles

arabiensis in the Tihama region of Saudi Arabia and Yemen.

PhD thesis, University of Liverpool – Liverpool School of tropi-

cal medicine.

Al-Sheik, A. A. 2011 Larval habitat, ecology, seasonal abun-

dance and vectorial role in malaria transmission of Anopheles

arabiensis in Jazan Region of Saudi Arabia. Journal of the

Egyptian Society of Parasitology.41 (3): pp. 615-634.

Beier J., Asiago C., Onyango K., and Koros J.1988: ELISA

absorbance cut-off method affected malaria sporozoite rate

determination in wild Afrotropical Anopheles. Medical and

Veterinary Entomology.2: 259-264.

Beier, J, and Koros, J. 1991: Visual assessment of sporozoite

and blood meal ELISA samples in malaria  eld studies. J. Med.

Entomol. (28): pp. 805-8.

Burkot T., Zavala F., Gwadz R., Collins F., Nurssenweig R., and

Roberts D. 1984: Identi cation of malaria-infected mosquitoes

by a two-site enzyme-linked immunosorbant assay. American

Journal of Tropical Medicine and Hygiene. 33(2): 227-231.

Coetzee, M, and Le Sueur, D. 1988: Effects of salinity on the

larvae of some Afro-tropical anopheline mosquitoes. Med. Vet.

Entomol. 2, (4): pp. 385-90.

Cowman, A. F., &Crabb, B. S. 2006: Invasion of red blood cells

by malaria parasites.Cell.124 (4): pp. 755-766.

Dash AP, Bendle MS, Das AK, Das M, Dwivedi SR. 1982: Role

of Anopheles annularis as a vector of malaria in the inland of

Orissa. J Com Dis. 14(3): 224.

Dye, C. 1986:Vectorial Capacity: Must we measure all its com-

ponents? Parasitology Today. 2(8): 203-209.

El Hassan, I. M., Sahly, A., Alzahrani, M. H., Alhakeem, R.

F., Alhelal, M.,Alhogail, A.andAtas, M. 2015: Progress toward

malaria elimination in Jazan Province, Kingdom of Saudi Ara-

bia: 2000–2014.Malaria journal.14 (1): pp. 1-10.

Elmahdi Z.A, 1Nugud A.A., and Elhassan I.M. 2012: Estima-

tion of malaria transmission intensity in Sennar state, central

Sudan.EMRO Bulletin.18(9):951-6.

Gama, B. E., do ES Silva-Pires, F., Lopes, M. N. K. R., Car-

doso, M. A. B., Britto, C., Torres, K. L., and de Fátima Ferreira-

da-Cruz, M.2007: Real-time PCR versus conventional PCR for

malaria parasite detection in low-grade parasitemia. Experi-

mental parasitology.116 (4): pp. 427-432.

Garret- Jones, C., and Shidrawi G. 1969: Malaria vectorial

capacity of a population of Anopheles gambiae: an exercise

in epidemiological entomology. Bulletin of the World Health

Organization. 40(4): 531 -545.

Ghosh KK, Chakarborty S, Bhattacharya S, Palit A, NeelamTan-

don, Hati AK. 1985: Anopheles annularis as a vector of malaria

in rural West Bengal. Indian J Malariol. 22: 65–70.

Glick, JI. 1992: Illustrated key to the female Anopheles of

South Western Asia & Egypt. Mosq. Syst. 24(2): 125-153.

Gunasekaran K, Sahu SS, Parida SK, Sadanandane C, Jam-

bulingam P, Das PK. 1989:Anopheline fauna of Koraput dis-

trict, Orissa State, with particular reference to transmission of

malaria. Indian J Med Res. 89: 340–3.

Hamad AA, NugudAel H, Arnot DE et al. 2002: A marked sea-

sonality of malaria transmission in two rural sites in eastern

Sudan. ActaTropica. 83, 71–82.

Harada M, Ishikawa H, Matsuoka H, Ishii A. Suguri S. 2000:

Estimation of the sporozoite rate of malaria vector using the

polymerase chain reaction and a mathematical model. Acta

Med Okayama. 54(4): 165–71.

Mahapatra, N., N.S. Marai, M.R. Ranjit, S.K. Parida, D.P. Hans-

dah, R.K. Hazra& S.K. Kar. 2006: Detection of Plasmodium

Dafalla et al.

BIOSCIENCE BIOTECHNOLOGY RESEARCH COMMUNICATIONS DETECTION OF

PLASMODIUM

ANOPHELES ARABIENSIS

falciparum infection in Anopheles mosquitoes from Keonjhar

district, Orissa, India. J Vect Borne Dis. 43, pp. 191–194.

Mattingly, PF & Knight KL. 1956: The mosquito of Arabia, I.

Bull. Brit. Meus. Nat. Hist.( Ent.). 4(3): 89- 141.

Moody, A. 2002:Rapid diagnostic tests for malaria para-

sites.Clin. Microbial.Rev.(15): pp.66-78.

Morassin, B., R. Fabre, A. Berry, and J. F. Magnaval.

2002: One year’s experience with the polymerase chain

reaction as a routine method for the diagnosis of imported

malaria.Am. J. Trop. Med. Hyg.(66): pp. 503-508.

Oneeb M., Maqbool A., Lateef M., Babar M. E. 2015: Detection

of Plasmodium falciparum infection in Anopheles stephensi

in Punjab, Pakistan. Pakistan journal of zoology. 47(4):1192-

1195.

Reisen,W., and Boreham,P. 1982: Estimates of malaria vectorial

capacity for Anopheles culicifacious and Anopheles stephensi

in rural Punjab province Pakistan. Journal of Medical Ento-

mology. 19(1):98-103.

Scott JA, Brogdon WG, Collins FH. 1993: Identi cation of

single specimens of the Anopheles gambiae complex by the

polymerase chain reaction. Am J Trop Med Hyg.49: 520-

529.

Sebai, Z. 1988: Malaria in Saudi Arabia. Trop. Doctor. (18):

pp. 183-88.

Shililu J, Ghebremeskel T, Seulu F et al. 2004: Seasonal abun-

dance, vector behavior, and malaria parasite transmission in

Eritrea. J Am Mosq Control Assoc. 20, 155-64.

Snounou, G. S., S. Viriyakosol, X. P. Zhu, W. Jarra, L. Pinheiro,

V. E. do Rosario, S. Thaithong, and K. N. 1993a: Brown. High

sensitivity of detection of human malaria parasites by the use

of nested polymerase chain reaction. MolBiochemParasitol.

61(2):315-20.

Snounou G, Pinheiro L, Goncalves A , Fonseca L, Dias F, Brown

KN. 1993b: The importance of sensitive detection of malaria

parasites in the human and insect hosts in epidemiological

studies, as shown by the analysis of  eld sample from Guinea

Bissau. Trans R Soc Trop Med Hyg. 87: 649–53.

Tassanakajon A, Boonsaeng V, Wilairat P, Panyim S. 1993:

Polymerase chain reaction detection of Plasmodium falci-

parum in mosquitoes. Trans R Soc Trop Med Hyg. 87: 273–5.

Tirados I, Costantini C, Gibson G, Torr SJ 2006: Blood-feed-

ing behaviour of the malarial mosquito Anopheles arabiensis:

implications for vector control.Med Vet Entomol. 20(4):425-37.

Waters AP, McCutchan TF. 1989: Rapid, sensitive diagnosis of

malaria based on ribosomal RNA. Lancet. 17; 1 (8651) 1343–

1346.

WHO. 1992: Entomological  eld techniques for malaria con-

trol. Part I, Learners guide. Geneva, World Health Organization.

WHO. 2011: World malaria report 2011. Geneva, World Health

Organization.

WHO. 2014: World malaria report 2013. Geneva: World

Health Organization; http://www.who.int/malaria/publica-

tions/ world_malaria_report_2013/en/.

WHO. 2016: Malaria Fact sheet. 2016. Available from: http://

www.who.int/mediacentre/factsheets/fs094/en/ (Accessed:

25/04/2016).

Wilson MD, Ofosu-Okyere A, Okoli AU, McCall PJ, Snounou

G. 1998: Direct comparison of microscopy and polymerase

chain reaction for the detection of Plasmodium sporozoites in

salivary glands of mosquitoes. Trans R Soc Trop Med Hyg. 92:

482–3.

Wirtz, R. A., T. R. Burkot, P. M. Graves, and R. G. Andre. 1987:

Field evaluation of enzyme-linked immunosorbent assays for

Plasmodium falciparum and Plasmodium vivax sporozoites in

mosquitoes (Diptera: Culicidae) from Papua New Guinea. J.

Med. Entomol. 24: 433-437.

Zahar, A. 1985: Vector Bionomics in Epidemiology and Control

of Malaria Part I, WHO Geneva.